rsbW
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

rsbW
168

anti-[wiki|sigma factor] to [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB], protein serine kinase, phosphorylates [protein|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]

locus
BSU_04720
Molecular weight
17.85 kDa
pI
4.28
Protein length
Gene length
function
control of [protein|search|SigB ]activity
product
anti-[wiki|sigma factor], protein serine kinase
essential
no
synonyms
rsbW

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2172

This gene is a member of the following regulons

Gene
Coordinates
522,414  522,896
The protein
Catalyzed reaction/ biological activity
phosphorylation of [protein|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]
negative regulator (by binding) of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]
ATP + L-seryl-[protein] --> ADP + H+ + O-phospho-L-seryl-[protein] (according to UniProt)
ATP + L-threonyl-[protein] --> ADP + H+ + O-phospho-L-threonyl-[protein] (according to UniProt)
Protein family
anti-sigma-factor family (with [protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB], according to UniProt)
Structure
[PDB|1TIL] ([protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB], 32% identity) [pubmed|15236958]
[AF|P17904]
Expression and Regulation
Operons
genes
[gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]-[gene|841CE7FCA4E84445830CA18F9856F6F30014E3BB|rsbS]-[gene|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT]-[gene|0B8381D2C724DAA724E4AFC67000F12AD112D13D|rsbU]-[gene|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]-[gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]-[gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]-[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]
description
[Pubmed|8002610]
regulation
''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|20454630], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8002610], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]→[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]

2022-08-02 18:49:42

ghost

34

5f220975cc2493224a8aa0770ee2187c815a2127

3EFC8DC1AC54632D4F2AC30497749AB5CCA3A39F

genes
[gene|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]-[gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]-[gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]-[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]
description
[Pubmed|2170324]
regulation
''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
Open in new tab

[gene|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]→[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]

2022-08-06 15:46:46

ghost

33

c245857c04f8cca86e1f0627f3b25353c582e66e

E6CC0B507AA5819A4C5EBF800596629708A2B80D

Biological materials
Mutant
BKE04720 ([gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCGATGTAATCAGCATTAT,  downstream forward: _UP4_TATTTAAATGGGGAGCGAGT
BKK04720 ([gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCGATGTAATCAGCATTAT,  downstream forward: _UP4_TATTTAAATGGGGAGCGAGT
labs
[wiki|Bill Haldenwang], San Antonio, USA
[wiki|Chet Price], Davis, USA [http://foodscience.ucdavis.edu/price_lab/pricelab.html homepage]
References
Reviews
33042030
Original Publications
8682789,8144446,8002610,8682769,11591687,8955331,8460143,8808936,8824586,8764398,7601843,15342585,12270815,23524614,11544224,23407164,21979936,25278935,27977677,15236958

5AF5F199C5D92E13DE1C56E28948A557E3954CBF

Page visits: 3457

Time of last update: 2022-08-03 17:52:48

Author of last update: Jstuelk