SubtiWiki SubtiWiki
yhjN

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yhjN
168

unknown

locus
BSU_10570
Molecular weight
40.87 kDa
pI
10.03
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yhjN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3180

This gene is a member of the following regulons

Gene
Coordinates
1,130,918  1,132,072
The protein
Protein family
AbrB family (single member, according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|5B34AA048061E4FD619B965744A25D0CE17562FC|yhjN]
description
[Pubmed|22383849]
Open in new tab

[gene|5B34AA048061E4FD619B965744A25D0CE17562FC|yhjN]

2021-09-02 16:51:49

Jstuelk

4

e699acda57747baa3697b768ca70b307f9e0245f

072E004E70996FECDDB6ABF9D8A7CF667D94B427

Biological materials
Mutant
MGNA-A727 (yhjN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/727 NBRP B. subtilis, Japan]
BKE10570 ([gene|5B34AA048061E4FD619B965744A25D0CE17562FC|yhjN]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTAAAACCCTTCTTCC,  downstream forward: _UP4_TAGTTGAAAAAAGGGTTCAA
BKK10570 ([gene|5B34AA048061E4FD619B965744A25D0CE17562FC|yhjN]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTAAAACCCTTCTTCC,  downstream forward: _UP4_TAGTTGAAAAAAGGGTTCAA

5B34AA048061E4FD619B965744A25D0CE17562FC

Page visits: 1355

Time of last update: 2022-01-23 20:39:51

Author of last update: Melvin.boenninger