SubtiWiki SubtiWiki
ycbD

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ycbD
168

NADP+-dependent alpha-ketoglutaric semialdehyde dehydrogenase

locus
BSU_02470
Molecular weight
52.25 kDa
pI
4.79
Protein length
Gene length
function
utilization of D-glucarate/galactarate
product
NADP+-dependent alpha-ketoglutaric semialdehyde dehydrogenase
essential
no
ec
1.2.1.3
synonyms
ycbD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1012

This gene is a member of the following regulons

Gene
Coordinates
268,846  270,312
The protein
Catalyzed reaction/ biological activity
2,5-dioxopentanoate + H2O + NADP+ --> 2-oxoglutarate + 2 H+ + NADPH (according to UniProt)
Protein family
[wiki|aldehyde dehydrogenase family] (according to UniProt)
[wiki|Cofactors]
NAD+
Structure
[PDB|3RHH] (from from ''Bacillus halodurans'' C-125 complexed with NADP, 36% identity, 69% similarity)
Paralogous protein(s)
[protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|ywdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|gabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|aldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY], [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]
Expression and Regulation
Operons
genes
[gene|3542BC20C11985B3CFAA4F930E8D794700ADFD2E|ycbC]-[gene|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD]-[gene|9C4932DA4DEF99263E57871A99684E3DAD93E1EC|ycbE]-[gene|372F2A420309DB0193AEF36A740EBA26410F97F2|ycbF]-[gene|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]-[gene|BA556E144975921DFDD598B0A7480C65176F0F14|ycbH]-[gene|349C99C258331962455100E2662DA2272E946C8A|ycbJ]
description
[Pubmed|12044674]
regulation
induced by D-glucarate/galactarate ([protein|search|YcbG]) [Pubmed|12044674]
regulatory mechanism
[protein|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]: repression, [Pubmed|12044674], in [regulon|protein:1A65880F68898002EE8774F34EDC47F0243B7273|ycbG regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|18840696], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|3542BC20C11985B3CFAA4F930E8D794700ADFD2E|ycbC]→[gene|349C99C258331962455100E2662DA2272E946C8A|ycbJ]

2022-01-12 17:16:17

ghost

18

a8e395a36da4d417bafa3e16f332fbbf2dcf2e61

24EBFC92FB6A93BD115AC81FF68694FB539EE76E

Biological materials
Mutant
BKE02470 ([gene|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCCATTGCCCCTTTCG,  downstream forward: _UP4_TAATGGTGCTGGAAAGAGGC
BKK02470 ([gene|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCCATTGCCCCTTTCG,  downstream forward: _UP4_TAATGGTGCTGGAAAGAGGC
References
12044674,17202142

5B66ADB81AB141982F187B1C5E3A9346AA064DE2

Page visits: 1031

Time of last update: 2022-01-20 00:35:50

Author of last update: Melvin.boenninger