

NADP+-dependent alpha-ketoglutaric semialdehyde dehydrogenase

Molecular weight
52.25 kDa
Protein length
Gene length
utilization of D-glucarate/galactarate
NADP+-dependent alpha-ketoglutaric semialdehyde dehydrogenase

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1012

This gene is a member of the following regulons

268,846  270,312
The protein
Catalyzed reaction/ biological activity
2,5-dioxopentanoate + H2O + NADP+ --> 2-oxoglutarate + 2 H+ + NADPH (according to UniProt)
Protein family
[wiki|aldehyde dehydrogenase family] (according to UniProt)
[PDB|3RHH] (from from ''Bacillus halodurans'' C-125 complexed with NADP, 36% identity, 69% similarity)
Paralogous protein(s)
[protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|ywdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|gabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|aldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY], [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]
Expression and Regulation
induced by D-glucarate/galactarate ([protein|search|YcbG]) [Pubmed|12044674]
regulatory mechanism
[protein|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]: repression, [Pubmed|12044674], in [regulon|protein:1A65880F68898002EE8774F34EDC47F0243B7273|ycbG regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|18840696], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab


2022-11-27 13:24:43





Biological materials
BKE02470 ([gene|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCCATTGCCCCTTTCG,  downstream forward: _UP4_TAATGGTGCTGGAAAGAGGC
BKK02470 ([gene|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCCATTGCCCCTTTCG,  downstream forward: _UP4_TAATGGTGCTGGAAAGAGGC


Page visits: 1191

Time of last update: 2022-11-28 08:13:57

Author of last update: Melvin.boenninger