yvfU

yvfU
168

two-component response regulator

locus
BSU_34060
Molecular weight
22.18 kDa
pI
5.08
Protein length
Gene length
function
unknown
product
two-component response regulator
essential
no
synonyms
yvfU

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2197

This gene is a member of the following regulons

Gene
Coordinates
3,495,876  3,496,478
The protein
[wiki|Domains]
[wiki|Response regulatory domain] (aa 3-119) (according to UniProt)
[wiki|HTH luxR-type domain] (aa 133-198) (according to UniProt)
Structure
[PDB|4LDZ] ([protein|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|desR], 59% identity) [pubmed|25406381]
[AF|O07019]
Modification
phosphorylated on Arg-116 and Arg-143 (phosphorylation serves as tag for degradation by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]) [Pubmed|27749819]
phosphorylated by [protein|91110611D775A1746766D43BDF50F2F6D345B625|yvfT] on an Asp residue [pubmed|33324680]
Paralogous protein(s)
[protein|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|desR]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Biological materials
Mutant
MGNA-A496 (yvfU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/496 NBRP B. subtilis, Japan]
BKE34060 ([gene|5BB2B90D5DDD50DD9B4EF9E69925FCBFA642222B|yvfU]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ACGAATCATTCTTTTCGTCC,  downstream forward: _UP4_TAACCATATACTGCACTCCT
BKK34060 ([gene|5BB2B90D5DDD50DD9B4EF9E69925FCBFA642222B|yvfU]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ACGAATCATTCTTTTCGTCC,  downstream forward: _UP4_TAACCATATACTGCACTCCT
References
10094672,27749819,25406381,33324680

5BB2B90D5DDD50DD9B4EF9E69925FCBFA642222B

Page visits: 1064

Time of last update: 2023-02-04 20:49:51

Author of last update: Jstuelk