SubtiWiki SubtiWiki
cadA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

cadA
168

cadmium transporting ATPase, resistance to cadmium

locus
BSU_33490
Molecular weight
75.22 kDa
pI
6
Protein length
Gene length
function
cadmium export
product
cadmium transporting ATPase
essential
no
ec
3.6.3.3
synonyms
cadA, yvgW

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2217

This gene is a member of the following regulons

Gene
Coordinates
3,438,853  3,440,952
The protein
Catalyzed reaction/ biological activity
ATP + Cd2+ + H2O --> ADP + Cd2+ + H+ + phosphate (according to UniProt)
ATP + H2O + Zn2+ --> ADP + H+ + phosphate + Zn2+ (according to UniProt)
Protein family
[wiki|cation transport ATPase (P-type) (TC 3.A.3) family] (according to UniProt)
[wiki|Domains]
HMA domain (aa 5-73) (according to UniProt)
Structure
[PDB|4BBJ] (CopA from ''Legionella pneumophila'', 32% identity, 67% similarity) [Pubmed|24317491]
Paralogous protein(s)
[protein|727024F7B1AC19676ED4B516CF46A47B1328310B|copA], [protein|017A57F27DD8E515242FB658A61E74C1D58273CC|pfeT]
[wiki|Localization]
cell membrane (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|5BC6B02770E74FF6D453742832574A87BB2369B8|cadA]
description
[Pubmed|12779235]
regulation
induced by toxic metal ions (Zn(II), Cd(II), Co(II), Ni(II) and Cu(II)) ([protein|search|CzrA]) [Pubmed|12779235,15948947]
regulatory mechanism
[protein|6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|czrA]: repression, [Pubmed|15948947], in [regulon|protein:6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|czrA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12779235], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|5BC6B02770E74FF6D453742832574A87BB2369B8|cadA]

2022-01-25 10:20:02

ghost

8

c8f031a68b274ddc69d3f57b3dc3a1d4c44da436

5EC07A989E7B6703C5B17018D7024EDE128B30BF

Biological materials
Mutant
MGNA-A491 (yvgW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/491 NBRP B. subtilis, Japan]
BKE33490 ([gene|5BC6B02770E74FF6D453742832574A87BB2369B8|cadA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTAGTCTCACCTTACCTT,  downstream forward: _UP4_TAAATTGTCGGAGAGAATTC
BKK33490 ([gene|5BC6B02770E74FF6D453742832574A87BB2369B8|cadA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTAGTCTCACCTTACCTT,  downstream forward: _UP4_TAAATTGTCGGAGAGAATTC
labs
[wiki|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
References
15948947,12779235,24317491,11934502,25213752

5BC6B02770E74FF6D453742832574A87BB2369B8

Page visits: 1811

Time of last update: 2022-01-26 04:36:24

Author of last update: Melvin.boenninger