cadA

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

cadA
168

cadmium transporting ATPase, resistance to cadmium

locus
BSU_33490
Molecular weight
75.22 kDa
pI
6
Protein length
Gene length
function
cadmium export
product
cadmium transporting ATPase
essential
no
ec
3.6.3.3
synonyms
cadA, yvgW

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2217

This gene is a member of the following regulons

Gene
Coordinates
3,438,853  3,440,952
The protein
Catalyzed reaction/ biological activity
ATP + Cd2+ + H2O --> ADP + Cd2+ + H+ + phosphate (according to UniProt)
ATP + H2O + Zn2+ --> ADP + H+ + phosphate + Zn2+ (according to UniProt)
Protein family
[wiki|cation transport ATPase (P-type) (TC 3.A.3) family] (according to UniProt)
[wiki|Domains]
HMA domain (aa 5-73) (according to UniProt)
Structure
[PDB|4BBJ] (CopA from ''Legionella pneumophila'', 32% identity, 67% similarity) [Pubmed|24317491]
[AF|O32219]
Paralogous protein(s)
[protein|727024F7B1AC19676ED4B516CF46A47B1328310B|copA], [protein|017A57F27DD8E515242FB658A61E74C1D58273CC|pfeT]
[wiki|Localization]
cell membrane (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|5BC6B02770E74FF6D453742832574A87BB2369B8|cadA]
description
[Pubmed|12779235]
regulation
induced by toxic metal ions (Zn(II), Cd(II), Co(II), Ni(II) and Cu(II)) ([protein|search|CzrA]) [Pubmed|12779235,15948947]
regulatory mechanism
[protein|6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|czrA]: repression, [Pubmed|15948947], in [regulon|protein:6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|czrA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12779235], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|5BC6B02770E74FF6D453742832574A87BB2369B8|cadA]

2022-04-27 23:19:52

ghost

14

c8f031a68b274ddc69d3f57b3dc3a1d4c44da436

5EC07A989E7B6703C5B17018D7024EDE128B30BF

Biological materials
Mutant
MGNA-A491 (yvgW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/491 NBRP B. subtilis, Japan]
BKE33490 ([gene|5BC6B02770E74FF6D453742832574A87BB2369B8|cadA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTAGTCTCACCTTACCTT,  downstream forward: _UP4_TAAATTGTCGGAGAGAATTC
BKK33490 ([gene|5BC6B02770E74FF6D453742832574A87BB2369B8|cadA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTAGTCTCACCTTACCTT,  downstream forward: _UP4_TAAATTGTCGGAGAGAATTC
labs
[wiki|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
References
15948947,12779235,24317491,11934502,25213752

5BC6B02770E74FF6D453742832574A87BB2369B8

Page visits: 1984

Time of last update: 2022-05-19 17:30:03

Author of last update: Melvin.boenninger