SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


transcription repressor of the [gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]-[gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]-[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD] and [gene|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA]-[gene|B90D4E798145F2AF3421DDC5AB6CD578E2E17900|gbsB] operons

Molecular weight
20.92 kDa
Protein length
Gene length
regulation of osmoprotection
transcription repressor
gbsR, yuaC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1510

This gene is a member of the following regulons

3,186,763  3,187,305
The protein
Catalyzed reaction/ biological activity
sensing of choline and arsenocholine [Pubmed|29159878,22408163]
control of the [gene|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA]-[gene|B90D4E798145F2AF3421DDC5AB6CD578E2E17900|gbsB] and [gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]-[gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]-[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD] operons [Pubmed|22408163]
Protein family
GbsR family (with [protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR] and [protein|4D288C63F68A9A4B39535D849D455B49F4E65050|yvaV], according to UniProt)
Effectors of protein activity
binds the inducer choline with an apparent K(D) of approximately 165 M [Pubmed|22408163]
binds the inducer arsenocholine with an apparent K(D) of approximately 2.1 mM [Pubmed|29159878]
Expression and Regulation
Open in new tab


2021-10-10 08:02:11





Biological materials
MGNA-A219 (yuaC::erm), available at the [ NBRP B. subtilis, Japan]
BKE31070 ([gene|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|gbsR]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACTGACCCTCTTTTCCT,  downstream forward: _UP4_TAAAGCAGAAAACGCCTGGG
BKK31070 ([gene|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|gbsR]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACTGACCCTCTTTTCCT,  downstream forward: _UP4_TAAAGCAGAAAACGCCTGGG
[wiki|Erhard Bremer], University of Marburg, Germany [ homepage]


Page visits: 1916

Time of last update: 2022-01-18 17:36:45

Author of last update: Jstuelk