ybxH

ybxH
168

sporulation protein

locus
BSU_02080
Molecular weight
7.34 kDa
pI
4.19
Protein length
Gene length
function
unknown
product
sporulation protein
essential
no
ec
null
synonyms
ybxH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
228,331  228,522
The protein
Structure
[AF|P54426]
Expression and Regulation
Operons
genes
[gene|07813844C05DB8670B810251979782094D184549|csgA]-[gene|5C81DD256BDEE777EE67566D3061131CFFAEAF21|ybxH]
description
[Pubmed|9016963]
regulation
expressed during sporulation in the forespore ([wiki|SpoVT]) [Pubmed|9016963]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: repression, in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,9016963], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|07813844C05DB8670B810251979782094D184549|csgA]→[gene|5C81DD256BDEE777EE67566D3061131CFFAEAF21|ybxH]

2022-12-14 02:23:23

ghost

11

b77e88be3141aa65cfab6b542dca87533d5e9383

A06F2DB99E1B2C47FDF3845D0DEE2F4A3812C681

Biological materials
Mutant
MGNA-B975 (ybxH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1974 NBRP B. subtilis, Japan]
BKE02080 ([gene|5C81DD256BDEE777EE67566D3061131CFFAEAF21|ybxH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCTCCCATTTCTTACCCGC,  downstream forward: _UP4_TAGAGCCCTGCCGTGCAGGG
BKK02080 ([gene|5C81DD256BDEE777EE67566D3061131CFFAEAF21|ybxH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCTCCCATTTCTTACCCGC,  downstream forward: _UP4_TAGAGCCCTGCCGTGCAGGG
References
15699190,9016963

5C81DD256BDEE777EE67566D3061131CFFAEAF21

Page visits: 576

Time of last update: 2023-02-06 15:23:40

Author of last update: Bzhu