pyrF

pyrF
168

orotidine 5-phosphate decarboxylase

locus
BSU_15550
Molecular weight
25.84 kDa
pI
5.84
Protein length
Gene length
function
pyrimidine biosynthesis
product
orotidine-5-phosphate decarboxylase
essential
no
ec
4.1.1.23
synonyms
pyrF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0284

This gene is a member of the following regulons

Gene
Coordinates
1,628,622  1,629,341
Phenotypes of a mutant
poor growth [pubmed|28189581]
non-transformable [pubmed|28189581]
The protein
Catalyzed reaction/ biological activity
H+ + orotidine 5'-phosphate --> CO2 + UMP (according to UniProt)
Protein family
OMP decarboxylase family (single member, according to UniProt)
Structure
[PDB|1DBT]
[AF|P25971]
Expression and Regulation
Operons
genes
[gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]
description
[Pubmed|8206849]
regulation
induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
regulatory mechanism
[protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]: termination/ antitermination, via [wiki|RNA switch], in [regulon|protein:6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1709162], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]→[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]

2022-11-30 16:13:08

ghost

46

3b978222b0b6a5230a2e7701ac35d1e35cc85307

0A8FD5CB6489EDD8CB2074130B763DCAC1F24654

Biological materials
Mutant
BKE15550 ([gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAGTGTTTCTTCAGCTGACG,  downstream forward: _UP4_GCCTATAAGGCTGTCAGACT
BKK15550 ([gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAGTGTTTCTTCAGCTGACG,  downstream forward: _UP4_GCCTATAAGGCTGTCAGACT
References
8206849,1709162,25326311,28189581

5D0D0D2413377FCA92440334E92B5A27A5963D9E

Page visits: 2402

Time of last update: 2022-12-02 18:17:25

Author of last update: Melvin.boenninger