epsE

epsE
168

inhibitor of motility and glycosyltransferase required for EPS biosynthesis

locus
BSU_34330
Molecular weight
32.05 kDa
pI
9.8
Protein length
Gene length
function
biofilm formation
product
glycosyltransferase, inhibitor of motility
essential
no
synonyms
epsE, yveO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0463

This gene is a member of the following regulons

Gene
Coordinates
3,524,417  3,525,253
Phenotypes of a mutant
smooth colonies on MsGG medium, no [wiki|biofilm formation] [Pubmed|22113911]
The protein
Catalyzed reaction/ biological activity
arrests flagellar rotation in a manner similar to that of a clutch, by disengaging motor force-generating elements in cells embedded in the biofilm matrix, separates the cytoplasmic [protein|8DDCC3D139ACCB635BF014946E1282A72D535390|fliG] motor from the [protein|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]-[protein|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB] stator [Pubmed|18566286]
biosynthesis of extracellular polysaccharides [Pubmed|21170308]
Protein family
[wiki|glycosyltransferase 2 family] (according to UniProt)
Structure
[AF|P71054]
Modification
phosphorylated by [protein|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB] on a Tyr residue [Pubmed|25085422]
[wiki|Localization]
cell membrane, forms spots at flagellar basal bodies [Pubmed|18566286]
Expression and Regulation
Operons
genes
[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]-[gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]-[gene|223E979276F07D69D0DDAEE906023A8AB4F37F8E|epsD]-[gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]-[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]-[gene|C4D81976AAE888C4FE89A2EE5CF9A763CAD645FF|epsG]-[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]-[gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]-[gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]-[gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]-[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]-[gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]-[gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]-[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]
description
[Pubmed|15661000]
regulation
repressed by [protein|search|SinR] [Pubmed|15661000]
regulatory mechanism
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]) [Pubmed|23646920], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
EAR riboswitch: processive antitermination, in [regulon|other_regulator:EAR riboswitch|EAR riboswitch]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15661000], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
Open in new tab

[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]→[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]

2022-11-30 16:09:04

ghost

53

972f8e32dbf02ccc05ec1b86b52f3e7c715bf4da

DAC70A15EA1F43CB18727990D26DF72F59759165

Biological materials
Mutant
MGNA-B613 (yveO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1612 NBRP B. subtilis, Japan]
BKE34330 ([gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTTCATACGCTTTTCTCCTT,  downstream forward: _UP4_AAGCATGAATAGCAGCCAAA
BKK34330 ([gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTTCATACGCTTTTCTCCTT,  downstream forward: _UP4_AAGCATGAATAGCAGCCAAA
labs
[wiki|Daniel Kearns], Indiana University, Bloomington, USA, [http://www.bio.indiana.edu/facultyresearch/faculty/Kearns.html homepage]
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
References
Reviews
20735481,24988880,25251856,31136265
Research papers
18566286,25085422,21170308,22113911
The EAR [wiki|RNA switch]
20374491,20230605

5D717F9F54693FD0AA8BC49E10348637858F88B9

Page visits: 4201

Time of last update: 2022-12-04 10:52:58

Author of last update: Jstuelk