

small acid-soluble spore protein (minor)

Molecular weight
5.22 kDa
Protein length
Gene length
protection of spore DNA
small acid-soluble spore protein (minor)

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5859

This gene is a member of the following regulons

1,930,264  1,930,410
The protein
Protein family
sspN family (single member, according to UniProt)
spore core (according to Swiss-Prot)
Expression and Regulation
expressed during sporulation in the forespore ([protein|search|SigF], [protein|search|SigG]) [Pubmed|15699190,10333516]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|15699190,10333516], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,10333516], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab


2022-12-10 23:30:27





additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
BKE18020 ([gene|5D79D9D38B588FE0EC688D54FE68E6F49238DA46|sspN]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATCCCTCCTCAAC,  downstream forward: _UP4_TAGCGAAAATTCGAGTTTAT
BKK18020 ([gene|5D79D9D38B588FE0EC688D54FE68E6F49238DA46|sspN]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATCCCTCCTCAAC,  downstream forward: _UP4_TAGCGAAAATTCGAGTTTAT


Page visits: 1101

Time of last update: 2023-02-06 06:27:59

Author of last update: Melvin.boenninger