epsC

epsC
168

UDP-N-acetylglucosamine 4,6-dehydratase, required for extracellular polysaccharide synthesis, this gene is inactive in B. subtilis 168

locus
BSU_34350
Molecular weight
66.09 kDa
pI
8.77
Protein length
Gene length
function
[category|SW.4.1.2|Biofilm formation], biosynthesis of N,N'-diacetylbacillosamine
product
UDP-N-acetylglucosamine 4,6-dehydratase
essential
no
synonyms
epsC, yveM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1086

This gene is a member of the following regulons

Gene
Coordinates
3,526,407  3,528,203
The protein
Protein family
[wiki|Polysaccharide synthase family] (according to UniProt)
[wiki|Cofactors]
NAD+ [pubmed|30222950]
Structure
[PDB|5BJW] (from Campylobacter jejuni, corresponds to the C-terminal part of EpsC, aa 242 ... 571, 47% identity) [pubmed|29053280]
[AF|P71052]
Paralogous protein(s)
[protein|F42B27D5D7F3F39828940E377ABCC0730B25EA88|yodU], (for SpsM)
[protein|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP], (for SpsM)
[wiki|Localization]
cell membrane (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]-[gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]-[gene|223E979276F07D69D0DDAEE906023A8AB4F37F8E|epsD]-[gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]-[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]-[gene|C4D81976AAE888C4FE89A2EE5CF9A763CAD645FF|epsG]-[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]-[gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]-[gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]-[gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]-[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]-[gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]-[gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]-[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]
description
[Pubmed|15661000]
regulation
repressed by [protein|search|SinR] [Pubmed|15661000]
regulatory mechanism
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]) [Pubmed|23646920], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
EAR riboswitch: processive antitermination, in [regulon|other_regulator:EAR riboswitch|EAR riboswitch]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15661000], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
Open in new tab

[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]→[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]

2022-11-30 16:09:04

ghost

53

972f8e32dbf02ccc05ec1b86b52f3e7c715bf4da

DAC70A15EA1F43CB18727990D26DF72F59759165

Biological materials
Mutant
MGNA-A071 (yveM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/71 NBRP B. subtilis, Japan]
BKE34350 ([gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGACAGTCTTCTCCGGT,  downstream forward: _UP4_AGCGTTCATTAGGGGGAGTG
BKK34350 ([gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGACAGTCTTCTCCGGT,  downstream forward: _UP4_AGCGTTCATTAGGGGGAGTG
References
Reviews
20384681,20735481
Research papers
27655338,30222950,29053280
The EAR [wiki|RNA switch]
20374491,20230605
Labs working on this gene/protein
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]

5DB168A3D087AAEB003D7548A1A4356ABD07F712

Page visits: 2751

Time of last update: 2022-12-01 19:04:42

Author of last update: Jstuelk