spoVE
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

spoVE
168

SEDS family peptidoglycan glycosyltransferase, required for spore cortex peptidoglycan synthesis

locus
BSU_15210
Molecular weight
39.97 kDa
pI
9.85
Protein length
Gene length
function
spore cortex peptidoglycan synthesis
product
SEDS family peptidoglycan glycosyltransferase
essential
no
synonyms
spoVE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0772

This gene is a member of the following regulons

Gene
Coordinates
1,590,317  1,591,417
The protein
Protein family
[wiki|SEDS proteins] (shape, elongation, division, and sporulation) [Pubmed|27525505]
SEDS family (with [protein|8AB7D225DBEE6BD695A4A8A2384D2C029B571C57|ftsW] and [protein|B405B3C21B464F904BBB2AFD5DA21ADE45B4DD96|rodA], according to UniProt)
Structure
[PDB|6BAR] (from Thermus thermophilus,corresponds to aa 99... 357, 38% identity) [pubmed|29590088]
[AF|P07373]
Paralogous protein(s)
[protein|8AB7D225DBEE6BD695A4A8A2384D2C029B571C57|ftsW], [protein|B405B3C21B464F904BBB2AFD5DA21ADE45B4DD96|rodA]
[wiki|Localization]
integral membrane protein, forespore [Pubmed|17981970]
Expression and Regulation
Operons
genes
[gene|D48B7591467C493D2214D37AEA83643FE8C27BC6|murE]-[gene|4D3D4429E1F387BACB0D5A1084AA8DF179A16685|mraY]-[gene|0A9FF5A66F73464A780914A1424979CE753B3D9C|murD]-[gene|5DE602D97D903D9AE38ED05D5A5F1B3A2DC1D58E|spoVE]-[gene|D52FDB5015B10E9B26D7FED5708457890C6EA43D|murG]-[gene|5E11616A51EE2CD1B8D3E33B18483521C504AD1F|murB]-[gene|B66FC02948DABBCE64DE2629D6E33E05647B4EEF|divIB]-[gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]-[gene|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|ylxX]-[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]
description
[Pubmed|1391053]
regulation
expressed during vegatative growth [Pubmed|1391053]
regulatory mechanism
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
[protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]: repression, [Pubmed|15383836], in [regulon|protein:90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|8320223], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|D48B7591467C493D2214D37AEA83643FE8C27BC6|murE]→[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]

2022-08-12 09:07:34

Jstuelk

24

68c6899b3f1263bd636c35a4ea9512c00078a714

2F040145AC628A38E3D11955965F4DA256DE6790

genes
[gene|5DE602D97D903D9AE38ED05D5A5F1B3A2DC1D58E|spoVE]
description
[Pubmed|1391053]
regulation
expressed during vegatative growth, then switched off, and again expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]) [Pubmed|1391053]
Open in new tab

[gene|5DE602D97D903D9AE38ED05D5A5F1B3A2DC1D58E|spoVE]

2022-07-29 08:56:36

Jstuelk

11

fd5dd6b3fdf4dc82269d42da79bf19874d2b0372

701B41302BA76AF066180683BB056619C8A71A9B

genes
[gene|5DE602D97D903D9AE38ED05D5A5F1B3A2DC1D58E|spoVE]-[gene|D52FDB5015B10E9B26D7FED5708457890C6EA43D|murG]-[gene|5E11616A51EE2CD1B8D3E33B18483521C504AD1F|murB]-[gene|B66FC02948DABBCE64DE2629D6E33E05647B4EEF|divIB]-[gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]-[gene|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|ylxX]-[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]
description
[Pubmed|1391053]
regulation
expressed during vegatative growth, then switched off, and again expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]) [Pubmed|1391053]
Open in new tab

[gene|5DE602D97D903D9AE38ED05D5A5F1B3A2DC1D58E|spoVE]→[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]

2022-07-24 14:58:30

Jstuelk

22

6fa043950e40c3a1d4f91339581472acb9db18da

C066C3357FB70D8EEB595C678C068B56731F8F59

additional information
the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
Biological materials
Mutant
BKE15210 ([gene|5DE602D97D903D9AE38ED05D5A5F1B3A2DC1D58E|spoVE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAGCAATCGACACCCCAA,  downstream forward: _UP4_TAACGAATGTATTTCCAAGC
BKK15210 ([gene|5DE602D97D903D9AE38ED05D5A5F1B3A2DC1D58E|spoVE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAGCAATCGACACCCCAA,  downstream forward: _UP4_TAACGAATGTATTTCCAAGC
References
Reviews
35638784
Original Publications
20417640,17981970,8320223,1391053,15383836,26883633,27525505,29590088,32152588,33573199

5DE602D97D903D9AE38ED05D5A5F1B3A2DC1D58E

Page visits: 2494

Time of last update: 2022-08-16 20:11:18

Author of last update: Jstuelk