SubtiWiki SubtiWiki
ymzB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ymzB
168

general stress protein, survival of ethanol and salt stresses

locus
BSU_17240
Molecular weight
13.25 kDa
pI
4.44
Protein length
Gene length
function
survival of ethanol and salt stresses
product
unknown
essential
no
ec
null
synonyms
ymzB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,860,014  1,860,370
Expression and Regulation
Operons
genes
[gene|3F53025AC42791F3378EAE5E7A0D6DC86C2765CF|ymaE]-[gene|5E811311BB4B5F637B768E526CE77FC91EE71C3E|ymzB]
description
[Pubmed|20817675]
regulation
induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|3F53025AC42791F3378EAE5E7A0D6DC86C2765CF|ymaE]→[gene|5E811311BB4B5F637B768E526CE77FC91EE71C3E|ymzB]

2021-11-19 16:46:03

Jstuelk

2

6aff758ee8e1d4cdd80580ff82ba26da9e7040ca

72AF8880B743D8AAADA04E084F9F343742DA5701

genes
[gene|5E811311BB4B5F637B768E526CE77FC91EE71C3E|ymzB]
description
[Pubmed|22383849]
Open in new tab

[gene|5E811311BB4B5F637B768E526CE77FC91EE71C3E|ymzB]

2021-12-18 15:42:44

Jstuelk

7

a5e49cb15671b09570dc0e6ee1e39fa85bb83340

C0892D1726BA7EC6D9068F6BF55D12E09B81E9D6

Biological materials
Mutant
MGNA-B108 (ymzB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1107 NBRP B. subtilis, Japan]
BKE17240 ([gene|5E811311BB4B5F637B768E526CE77FC91EE71C3E|ymzB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAATATTCCTCCTTTTG,  downstream forward: _UP4_TGACAGCCACTTTCATCAAA
BKK17240 ([gene|5E811311BB4B5F637B768E526CE77FC91EE71C3E|ymzB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAATATTCCTCCTTTTG,  downstream forward: _UP4_TGACAGCCACTTTCATCAAA
References
15805528,20817675

5E811311BB4B5F637B768E526CE77FC91EE71C3E

Page visits: 810

Time of last update: 2022-01-18 03:40:00

Author of last update: Bzhu