yirB

yirB
168

anti-adaptor protein, inhibits [protein|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH], responsible for stabilization of [protein|2C6386E9A63F410558D168798D077DF91590F454|spx] in response to cell wall stress

locus
BSU_33029
Molecular weight
6.60 kDa
pI
9.931
Protein length
Gene length
function
control of [protein|2C6386E9A63F410558D168798D077DF91590F454|spx] proteolysis
product
anti-adaptor protein
essential
no
synonyms
yirB, yuzO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,387,781  3,387,945
The protein
Catalyzed reaction/ biological activity
prevention of the [protein|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH]-[protein|2C6386E9A63F410558D168798D077DF91590F454|spx] interaction [Pubmed|21378193]
Structure
[PDB|5BRQ] (from B. licheniformis, 29% identity) [pubmed|26894535]
[AF|O32302]
Expression and Regulation
Operons
genes
[gene|5EC57A51EF2DC48070615653B7A3C1007CFEE01D|yirB]
description
[pubmed|30001325]
regulation
induced by vancomycin ([protein|A40CD2C23A19860342F440284302EFFDAC09E88A|cssR]-P) [pubmed|30001325]
induced by cell wall stress ([protein|A40CD2C23A19860342F440284302EFFDAC09E88A|cssR]) [pubmed|30001325]
regulatory mechanism
[protein|1D6C340264B8A75727E202AD2E37053091C94013|yuxN]: repression, [pubmed|30001325], in [regulon|protein:1D6C340264B8A75727E202AD2E37053091C94013|yuxN regulon]
[protein|A40CD2C23A19860342F440284302EFFDAC09E88A|cssR]: activation, CssR-P acts as anti-repressor [pubmed|30001325], in [regulon|protein:A40CD2C23A19860342F440284302EFFDAC09E88A|cssR regulon]
Open in new tab

[gene|5EC57A51EF2DC48070615653B7A3C1007CFEE01D|yirB]

2023-01-08 18:19:50

Jstuelk

18

2daafa47cec195cafe5661fe6a09076c65816b50

EB5D6C1BA612B5ACCCD9BB5C2012B82D8D5EDFB8

Biological materials
Mutant
BKE33029 ([gene|5EC57A51EF2DC48070615653B7A3C1007CFEE01D|yirB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE33029 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTAGATTCACCCTTTC,  downstream forward: _UP4_TAAAAAAATAGACTGCAAAA
BKK33029 ([gene|5EC57A51EF2DC48070615653B7A3C1007CFEE01D|yirB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33029 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTAGATTCACCCTTTC,  downstream forward: _UP4_TAAAAAAATAGACTGCAAAA
References
Reviews
23375660
Research papers
21378193,30001325,26894535

5EC57A51EF2DC48070615653B7A3C1007CFEE01D

Page visits: 1639

Time of last update: 2023-02-02 11:01:15

Author of last update: Jstuelk