ctpA

ctpA
168

carboxy-terminal processing protease, promotes DNA damage checkpoint recovery

locus
BSU_19590
Molecular weight
50.98 kDa
pI
8.86
Protein length
Gene length
function
unknown
product
carboxy-terminal processing protease
essential
no
synonyms
ctpA, yzbD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0793

This gene is a member of the following regulons

Gene
Coordinates
2,131,902  2,133,302
Phenotypes of a mutant
deletion of [protein|5ED8301B9681FDD5171A9344A971E891493A6558|ctpA] and [protein|1A5C1BDE844AA56B90C0E4A02D74978676487E99|ddcP] leads to accumulation of the checkpoint protein [protein|7BF591DCDC9635C605D76135481A8A9DB63EE861|yneA] [pubmed|29979679]
sensitivity to DNA damage [pubmed|29979679]
The protein
Catalyzed reaction/ biological activity
digestion of [protein|7BF591DCDC9635C605D76135481A8A9DB63EE861|yneA] [pubmed|29979679]
The enzyme shows specific recognition of a C-terminal tripeptide, Xaa-Yaa-Zaa, in which Xaa is preferably Ala or Leu, Yaa is preferably Ala or Tyr, and Zaa is preferably Ala, but then cleaves at a variable distance from the C-terminus. A typical cleavage is -Ala-Ala-|-Arg-Ala-Ala-Lys-Glu-Asn-Tyr-Ala-Leu-Ala-Ala (according to UniProt).
Protein family
Peptidase s41a family (together with [protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|ctpB], according to Uniprot)
[wiki|Domains]
signal peptide (aa 1 - 36) [pubmed|29979679]
[wiki|PDZ domain] (aa 96- 174) [pubmed|29979679]
S41 peptidase domain [pubmed|29979679]
peptidoglycan binding domain (C-terminal) [pubmed|29979679]
Structure
[PDB|4C2D] ([protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|ctpB], 42% identity) [pubmed|24243021]
[AF|O34666]
Paralogous protein(s)
[protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|ctpB]
[wiki|Localization]
cell membrane, with extracellular protease domain [pubmed|30315724]
Expression and Regulation
Operons
genes
[gene|5ED8301B9681FDD5171A9344A971E891493A6558|ctpA]
description
[Pubmed|22383849]
Open in new tab

[gene|5ED8301B9681FDD5171A9344A971E891493A6558|ctpA]

2022-12-13 17:56:30

Jstuelk

20

f5be2b175b884bc3a681b5ffa5a199185c777fc1

31FEB029459106EBD8CD82F2CC39C776759EE350

Biological materials
Mutant
MGNA-A087 (ctpA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/87 NBRP B. subtilis, Japan]
1A866 ( ''ctpA''::''cat''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A866&Search=1A866 BGSC]
BKE19590 ([gene|5ED8301B9681FDD5171A9344A971E891493A6558|ctpA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE19590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTAAACACCACCTTTTT,  downstream forward: _UP4_TAAAAAAAACCATACGCGGC
BKK19590 ([gene|5ED8301B9681FDD5171A9344A971E891493A6558|ctpA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK19590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTAAACACCACCTTTTT,  downstream forward: _UP4_TAAAAAAAACCATACGCGGC
References
Reviews
34410368
Original Publications
9734814,24243021,29979679,30315724

5ED8301B9681FDD5171A9344A971E891493A6558

Page visits: 1788

Time of last update: 2023-02-06 13:28:19

Author of last update: Jstuelk