

lactate catabolic enzyme

Molecular weight
26.13 kDa
Protein length
Gene length
utilization of lactate
lutC, yvbY

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1556

This gene is a member of the following regulons

3,492,797  3,493,519
Phenotypes of a mutant
no growth with lactate as the single carbon source [Pubmed|19201793]
The protein
Catalyzed reaction/ biological activity
oxidation of lactate to pyruvate [Pubmed|19201793]
Protein family
LutC/YkgG family (single member, according to UniProt)
phosphorylated on Arg-97 [Pubmed|22517742]
Expression and Regulation
induction by lactate [Pubmed|19201793]
regulatory mechanism
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|19201793], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
[protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]: repression, in [regulon|protein:E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|25031425], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2022-09-16 23:46:13





Other regulations
[protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA]: translation repression, [Pubmed|22427629]
[protein|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|fbpB]: translation inhibition, acts as RNA chaperone, increases interaction between [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA] and [protein|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]-[protein|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]-[protein|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|lutC] RNAs
Biological materials
MGNA-A470 (yvbY::erm), available at the [ NBRP B. subtilis, Japan]
BKE34030 ([gene|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|lutC]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTCTGAATGGTTCCCTTCG,  downstream forward: _UP4_TGAACTCAGGAAGCCCGGCA
BKK34030 ([gene|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|lutC]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTCTGAATGGTTCCCTTCG,  downstream forward: _UP4_TGAACTCAGGAAGCCCGGCA
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [ homepage]


Page visits: 1804

Time of last update: 2022-09-28 01:28:50

Author of last update: Melvin.boenninger