sigG

sigG
168

[wiki|RNA polymerase] [wiki|sporulation] forespore-specific (late) [wiki|sigma factor] SigG

locus
BSU_15330
Molecular weight
29.92 kDa
pI
5.5
Protein length
Gene length
function
transcription of [wiki|sporulation] genes (late forespore)
product
[wiki|RNA polymerase] [wiki|sporulation] forespore-specific (late) [wiki|sigma factor] SigG
essential
no
synonyms
sigG, spoIIIG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5813

This gene is a member of the following regulons

Gene
Coordinates
1,605,630  1,606,412
The protein
Protein family
[wiki|Sigma-70 factor family] (according to UniProt)
Structure
[PDB|1L0O] ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF] in complex with [protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB], Geobacillus stearothermophilus, 47% identity) [pubmed|11955433]
[AF|P19940]
Effectors of protein activity
[protein|01412FA454DDBA12622E3B32C433F8059123661B|csfB] inhibits SigG activity [Pubmed|19497328]
the activity of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]-containing [wiki|RNA polymerase] is modulated by [protein|8AB50581EBB3C27BB9A96EA3382F8C90CE5B6EC5|ylyA] [Pubmed|23678950]
Paralogous protein(s)
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]
Expression and Regulation
Operons
genes
[gene|221829E084DA78ACE1C2DFCEB6E59EDA534FF55D|spoIIGA]-[gene|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]-[gene|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]
description
[Pubmed|1902213]
regulation
''[wiki|spoIIGA]'': expressed under conditions that trigger sporulation ([wiki|Spo0A]) [http://www.ncbi.nlm.nih.gov/sites/entrez/8288522,15687200 PubMed]
regulatory mechanism
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [PubMed|8288522,15687200], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2512576], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|1902213], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
additional information
the mRNA half-life is about 2.6 min [PubMed|24163345]
Open in new tab

[gene|221829E084DA78ACE1C2DFCEB6E59EDA534FF55D|spoIIGA]→[gene|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]

2022-12-30 23:19:20

ghost

44

3354b759a5d3c11fb5b0d40216c1a7e1d8249a30

020EF37B0706DBB0AF1DC411F77E0B6D94001319

genes
[gene|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]
description
[Pubmed|1902213]
regulation
''[wiki|spoIIGA]'': expressed under conditions that trigger sporulation ([wiki|Spo0A]) [http://www.ncbi.nlm.nih.gov/sites/entrez/8288522,15687200 PubMed]
additional information
the mRNA half-life is about 2.6 min [PubMed|24163345]
a conserved hairpin in the 5' leader sequence of the [gene|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG] mRNA occludes the ribosome-binding site, this reduces translation by up to 4-fold [pubmed|29702640]
Open in new tab

[gene|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]

2023-02-03 19:52:48

Jstuelk

39

eba0bfafa2452d7bb4af940ab4e44f7cbc16dfc3

A3191BCF399586B987555C0E304550BD16906D4F

Biological materials
Mutant
BKE15330 ([gene|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTTTTTCCCTCCCTACA,  downstream forward: _UP4_TAATGAAAAGCCTTTAAAAC
BKK15330 ([gene|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTTTTTCCCTCCCTACA,  downstream forward: _UP4_TAATGAAAAGCCTTTAAAAC
labs
[wiki|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]
References
Reviews
20833318,31350897,35638784
Original Publications
1900507,1902463,15175314,10806362,1902213,2497051,12867473,16707705,9829949,1487728,2448286,9852018,19497328,8126438,8355618,24163345,18820020,2493633,7961403,15256570,12813085,9004507,8885263,18485064,19390092,23678950,22984259,20817675,21935351,25835496,29702640,11955433
The [wiki|SigG regulon]
16497325

5F24258282F3166B7696B9E9ABC1706E4D06C944

Page visits: 4873

Time of last update: 2023-02-06 12:44:25

Author of last update: Jstuelk