SubtiWiki SubtiWiki
ycdC

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ycdC
168

unknown

locus
BSU_02800
Molecular weight
52.04 kDa
pI
5.8
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ycdC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
302,435  303,796
Biological materials
Mutant
MGNA-B980 (ycdC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1979 NBRP B. subtilis, Japan]
BKE02800 ([gene|5F2FE4CFA2709AE95708541922944E99E1A3FEB1|ycdC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGAAGTCATCCCTTTCA,  downstream forward: _UP4_AAAAAGAAAAGGCTGTGAGG
BKK02800 ([gene|5F2FE4CFA2709AE95708541922944E99E1A3FEB1|ycdC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGAAGTCATCCCTTTCA,  downstream forward: _UP4_AAAAAGAAAAGGCTGTGAGG

5F2FE4CFA2709AE95708541922944E99E1A3FEB1

Page visits: 642

Time of last update: 2022-01-27 19:26:30

Author of last update: Bzhu