SubtiWiki SubtiWiki
iolR

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

iolR
168

transcriptional repressor of the iol operon, [wiki|DeoR family]

locus
BSU_39770
Molecular weight
28.25 kDa
pI
6.33
Protein length
Gene length
function
regulation of myo-inositol catabolism
product
transcriptional repressor
essential
no
synonyms
iolR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1349

This gene is a member of the following regulons

Gene
Coordinates
4,084,799  4,085,554
Phenotypes of a mutant
inactivation of ''[gene|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]'' reduces sporulation efficiency to 38% that of wild type cells [Pubmed|26735940]
The protein
[wiki|Domains]
[wiki|HTH deoR-type domain] (aa 1-57) (according to UniProt)
Effectors of protein activity
inducer: 2-deoxy-5-keto-D-gluconic acid-6-phosphate
Expression and Regulation
Operons
genes
[gene|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]-[gene|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|iolS]
description
[Pubmed|9226270]
regulation
induced by inositol ([protein|search|IolR]) [Pubmed|9226270]
regulatory mechanism
[protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]: repression, [Pubmed|9226270], in [regulon|protein:5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9226270], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]→[gene|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|iolS]

2021-08-08 08:30:16

ghost

5

8770699e2835badc7cbf5c9c4652defe40d236e1

FD73AC3FBA5FCDBE2F4BF70EFC6DCFA35CB11689

Biological materials
Mutant
BKE39770 ([gene|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATAAAAAACTCCTTCTT,  downstream forward: _UP4_TAACGTTTACAATAGTGTTG
BKK39770 ([gene|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATAAAAAACTCCTTCTT,  downstream forward: _UP4_TAACGTTTACAATAGTGTTG
labs
[wiki|Yasutaro Fujita], University of Fukuyama, Japan
[[Ken-ichi Yoshida]], Kobe University, Japan
References
18310071,9226270,9887260,9887260,18310071,26735940

5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE

Page visits: 2052

Time of last update: 2022-01-17 21:53:59

Author of last update: Melvin.boenninger