SubtiWiki SubtiWiki
ybdJ

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ybdJ
168

two-component response regulator ([wiki|OmpR family])

locus
BSU_02000
Molecular weight
26.03 kDa
pI
6.35
Protein length
Gene length
function
unknown
product
two-component response regulator ([wiki|OmpR family])
essential
no
synonyms
ybdJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0745

This gene is a member of the following regulons

Gene
Coordinates
221,258  221,929
The protein
Protein family
[wiki|OmpR family] of two-component response regulators
[wiki|Domains]
[wiki|Response regulatory domain] (aa 5-116) (according to UniProt)
Structure
[PDB|1KGS](from Thermotoga maritima, 32% identity) [pubmed|11839301]
Modification
phosphorylated by [protein|EA36C28A990EFFAEBFE279467A0B56B6B5F5255D|ybdK] on an Asp residue
Effectors of protein activity
phosphorylation likely affects DNA-binding activity
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Biological materials
Mutant
MGNA-B956 (ybdJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1955 NBRP B. subtilis, Japan]
BKE02000 ([gene|5F6D14A0B360832F9FD470668B006A628B109A56|ybdJ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GATTAAAATACGATAACCCT,  downstream forward: _UP4_TGAAGCTCAAGACAAAATAT
BKK02000 ([gene|5F6D14A0B360832F9FD470668B006A628B109A56|ybdJ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GATTAAAATACGATAACCCT,  downstream forward: _UP4_TGAAGCTCAAGACAAAATAT
References
10094672,23504016,11839301

5F6D14A0B360832F9FD470668B006A628B109A56

Page visits: 857

Time of last update: 2021-12-04 06:38:07

Author of last update: Melvin.boenninger