ykkC

ykkC
168

putative guanidine exporter

locus
BSU_13090
Molecular weight
11.78 kDa
pI
5.36
Protein length
Gene length
function
export/ detoxification of guanidine
product
subunit of guanidine exporter
essential
no
synonyms
ykkC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2076

This gene is a member of the following regulons

Gene
Coordinates
1,376,517  1,376,855
The protein
Protein family
paired small multidrug resistance  protein family ([wiki|PSMR family]) [Pubmed|17942072]
[wiki|drug/metabolite transporter (DMT) superfamily] (according to UniProt)
[wiki|Small multidrug resistance (SMR) (TC 2.A.7.1) family] (according to UniProt)
Structure
[PDB|5U3G] (the [wiki|riboswitch] from Dickeya dadantii, bound to guanidinium) [pubmed|28096518]
[AF|P49856]
[wiki|Localization]
cell membrane (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|5FD89F65E481CDC33B10A58C12C3168B929917ED|ykkC]-[gene|5001019AD87FEF7D7A920D570C1053D476F7F20C|ykkD]
description
[Pubmed|10735877]
regulation
induced in the presence of guanidine ([wiki|ykkC riboswitch]) [Pubmed|27989440]
regulatory mechanism
[protein|E9866855F0156859C45E98F3B385FE1263BB7EBC|YkkC riboswitch]: antitermination, [pubmed|28060483,27989440], in [regulon|protein:E9866855F0156859C45E98F3B385FE1263BB7EBC|YkkC riboswitch regulon]
Open in new tab

[gene|5FD89F65E481CDC33B10A58C12C3168B929917ED|ykkC]→[gene|5001019AD87FEF7D7A920D570C1053D476F7F20C|ykkD]

2022-11-21 14:42:33

ghost

15

12ef4a40f3191d055e1518a030274c88ec540d1a

CFA7D4F021B5D5A483940692B621927D162FE138

Biological materials
Mutant
MGNA-A747 (ykkC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/747 NBRP B. subtilis, Japan]
BKE13090 ([gene|5FD89F65E481CDC33B10A58C12C3168B929917ED|ykkC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGAGTCATTCCTTTC,  downstream forward: _UP4_GAGGAAAAAGGAGGCGAGGC
BKK13090 ([gene|5FD89F65E481CDC33B10A58C12C3168B929917ED|ykkC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGAGTCATTCCTTTC,  downstream forward: _UP4_GAGGAAAAAGGAGGCGAGGC
References
Reviews
17942072,28060483
Original Publications
15096624,10735877,21317561,27120414,27989440,28096518

5FD89F65E481CDC33B10A58C12C3168B929917ED

Page visits: 950

Time of last update: 2022-11-27 03:46:53

Author of last update: Melvin.boenninger