pel

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

pel
168

pectate lyase C

locus
BSU_07560
Molecular weight
45.34 kDa
pI
8.42
Protein length
Gene length
function
degradation of polygalacturonic acid
product
pectate lyase C
essential
no
ec
4.2.2.2
synonyms
pel

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3866

This gene is a member of the following regulons

Gene
Coordinates
827,993  829,255
The protein
Catalyzed reaction/ biological activity
Eliminative cleavage of (14)-alpha-D-galacturonan to give oligosaccharides with 4-deoxy-alpha-D-galact-4-enuronosyl groups at their non-reducing ends (according to UniProt)
Protein family
[wiki|lyase 1 family] (according to UniProt)
Structure
[PDB|2O1D] (bound to trisaccharide),  [PDB|1BN8], [PDB|5X2I]
[AF|P39116]
[wiki|Localization]
extracellular (signal peptide), major constituent of the secretome [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|60595234B02D673E860B364FE8A3C83D2CC68CB2|pel]
description
[Pubmed|12823818]
regulation
expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: repression, [Pubmed|12823818], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]: activation, ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]) [Pubmed|16091051], in [regulon|protein:7832489F11F606BCF637EC23BAAB41AD10237EBB|comA regulon]
Open in new tab

[gene|60595234B02D673E860B364FE8A3C83D2CC68CB2|pel]

2022-04-27 14:16:28

ghost

12

76400bab62705b87994cb03faede33a889fce495

10714B5E27307FB494D6E1512AD3F8A90541AB1B

Biological materials
Mutant
MGNA-C248 (pel::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2246 NBRP B. subtilis, Japan]
BKE07560 ([gene|60595234B02D673E860B364FE8A3C83D2CC68CB2|pel]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCACTATGTACCCCCAT,  downstream forward: _UP4_TAAGAAAGTGAAAAACACAA
BKK07560 ([gene|60595234B02D673E860B364FE8A3C83D2CC68CB2|pel]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCACTATGTACCCCCAT,  downstream forward: _UP4_TAAGAAAGTGAAAAACACAA
References
Reviews
20735481
Original Publications
8262178,16091051,12823818,18957862,12850135,25755103,7634076,26582911,27447541,27965289

60595234B02D673E860B364FE8A3C83D2CC68CB2

Page visits: 1477

Time of last update: 2022-05-20 00:25:06

Author of last update: Melvin.boenninger