SubtiWiki SubtiWiki
ptkA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ptkA
168

protein tyrosine kinase

locus
BSU_36250
Molecular weight
25.64 kDa
pI
9.63
Protein length
Gene length
function
protein phosphorylation
product
protein tyrosine kinase
essential
no
synonyms
ptkA, ywqD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0489

This gene is a member of the following regulons

Gene
Coordinates
3,731,822  3,732,535
Phenotypes of a mutant
Accumulation of extra chromosome equivalents [Pubmed|17367396]
Defect in [wiki|biofilm formation], this involves the kinase activity, but the target protein is unknown [Pubmed|20815827]
The protein
Catalyzed reaction/ biological activity
ATP + L-tyrosyl-[protein] --> ADP + H+ + O-phospho-L-tyrosyl-[protein] (according to UniProt)
autophosphorylation, phosphorylation of [protein|45AFD434F5262BFBE4ED6DF3D18DAED61FF317D1|ugd], [protein|DF8CD0B3997A7A4CF4821A7D64E9898422FD17E0|tuaD], [protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|ssbB], [protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|ssbB]
Protein family
BY-kinase, see the [http://bykdb.ibcp.fr/BYKdb/BYKdbHelp Bacterial Protein Tyrosine Kinase Database]
CpsD/CapB family (with [protein|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB], according to UniProt)
[wiki|Domains]
single BY-kinase domain
[wiki|Cofactors]
ATP
Structure
[PDB|2VED] (CapB, the homolog in ''Staphylococcus aureus'')
Modification
autophosphorylation at residues Y225, Y227 and Y228 (primary site) [Pubmed|20509597], dephosphorylated by [protein|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ] [Pubmed|15866923]
Effectors of protein activity
[protein|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA] - transmembrane modulator, activates PtkA autophosphorylation and substrate phosphorylation [Pubmed|12970183]
the mutually exclusive interactions of PtsA with the modulator proteins [protein|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA], [protein|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|salA], and probably [protein|37DAD42A391E2FC506225EAF91B8F21629A401DF|minD] direct the kinase to different substrates [Pubmed|27725816]
Paralogous protein(s)
[protein|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]
Expression and Regulation
Operons
genes
[gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]-[gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]-[gene|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ]-[gene|45AFD434F5262BFBE4ED6DF3D18DAED61FF317D1|ugd]
description
[Pubmed|20815827,12970183]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [Pubmed|26283769], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, [Pubmed|26283769], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|20815827], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]→[gene|45AFD434F5262BFBE4ED6DF3D18DAED61FF317D1|ugd]

2022-01-25 12:09:44

ghost

13

c2e9da4a42fde0cc0e5b798663a12ae407bf7d28

23621A956181A8BE93792267290B609197EA8EF4

Biological materials
Mutant
MGNA-A078 (ywqD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/78 NBRP B. subtilis, Japan]
KO strain created with pMUTIN-2, available from [wiki|Ivan Mijakovic]
GP1520 (spc), available in [wiki|Jörg Stülke]'s lab
GP1544 (ermC), available in [wiki|Jörg Stülke]'s lab
GP1587 (cat) , available in [wiki|Jörg Stülke]'s lab
GP1521 ''[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]'' (aphA3) ''[gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]'' (spc) double mutant available in [wiki|Jörg Stülke]'s lab
GP1529 ''[gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]-[gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]''::spc available in [wiki|Jörg Stülke]'s lab
GP1610 (''[gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]-[gene|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ]'', spc), available in [wiki|Jörg Stülke]'s lab
BKE36250 ([gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTGCATCCGCGAGCCTCTGT,  downstream forward: _UP4_TAAATAACGTGCATCGTGCC
BKK36250 ([gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTGCATCCGCGAGCCTCTGT,  downstream forward: _UP4_TAAATAACGTGCATCGTGCC
Expression vectors
pQE-30, N-terminally 6xHis-tagged, available from [wiki|Ivan Mijakovic]
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
lacZ fusion
in a KO strain created with pMUTIN-2, available from [wiki|Ivan Mijakovic]
GFP fusion
CFP-fusion, available from [wiki|Ivan Mijakovic]
labs
[wiki|Ivan Mijakovic], Thiverval-Grignon, France
References
Reviews
20497498,24554699,25540643,25667587,26286503
Original Publications
12970183,15741737,15866923,17367396,19258708,18547145,20497499,20509597,20815827,20817675,23939619,24493247,24728941,25278935,25374563,26283769,26094643,27148221,27725816

6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1

Page visits: 3547

Time of last update: 2022-01-28 10:15:59

Author of last update: Melvin.boenninger