SubtiWiki SubtiWiki
yhjP

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yhjP
168

similar to [wiki|ABC transporter] (peptide binding protein)

locus
BSU_10590
Molecular weight
66.20 kDa
pI
6.12
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yhjP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4533

This gene is a member of the following regulons

Gene
Coordinates
1,133,498  1,135,225
The protein
Protein family
C-terminal part: [wiki|bacterial solute-binding protein 5 family] (according to UniProt)
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 1-120) (according to UniProt)
Structure
[PDB|6TFX] (from Agrobacterium tumefaciens, corresponds to aa 130 ... 564, 23% identity) [pubmed|31922182]
Biological materials
Mutant
MGNA-A728 (yhjP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/728 NBRP B. subtilis, Japan]
BKE10590 ([gene|61D74BCF9E52A007C596A2C783496EF823FDC2F0|yhjP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATCCCCGCACCTCCCGAC,  downstream forward: _UP4_TAAAAAGAGGGTTCTTTTTT
BKK10590 ([gene|61D74BCF9E52A007C596A2C783496EF823FDC2F0|yhjP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATCCCCGCACCTCCCGAC,  downstream forward: _UP4_TAAAAAGAGGGTTCTTTTTT
References
Research papers
31922182

61D74BCF9E52A007C596A2C783496EF823FDC2F0

Page visits: 1032

Time of last update: 2022-01-18 16:58:37

Author of last update: Jstuelk