gltP

gltP
168

similar to H+/glutamate symporter, minor glyphosate transporter, not required for glutamate transport

locus
BSU_02340
Molecular weight
44.45 kDa
pI
8.65
Protein length
Gene length
function
unknown
product
similar to H+/glutamate symporter
essential
no
synonyms
gltP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1301

This gene is a member of the following regulons

Gene
Coordinates
253,518  254,762
The protein
Catalyzed reaction/ biological activity
uptake of glyphosate [pubmed|30666812]
Protein family
[wiki|dicarboxylate/amino acid:cation symporter (DAACS) (TC 2.A.23) family] (according to UniProt)
Structure
[PDB|4KY0] the glutamate transporter of ''Thermococcus kodakarensis'', 33% identity, 68% similarity) [Pubmed|24013209]
[AF|P39817]
Paralogous protein(s)
[protein|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|dctP], [protein|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]
description
[pubmed|22383849]
Open in new tab

[gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]

2022-11-28 23:29:37

Jstuelk

17

46fb4aeb3f0e0ebe874afd5cc4a8f5487b6aca16

D505AEF3AE5D58276369E7E5C1F680537ECE9A03

Biological materials
Mutant
ADB1 ([gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]::neo trpC2 pheA1 available in [wiki|Erhard Bremer]'s and [wiki|Jörg Stülke]'s labs [Pubmed|25344233]
GP2799 (Δ[gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]::''kan''), available in [wiki|Jörg Stülke]'s lab [pubmed|32743959]
GP2824 (Δ[gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]::''cat''), available in [wiki|Jörg Stülke]'s lab
GP2825 (Δ[gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]::''cat'' Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::''kan''), available in [wiki|Jörg Stülke]'s lab
BKE02340 ([gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATGAATCCCCCTTTAGA,  downstream forward: _UP4_TAGAAAAAAAGAACACCTCA
BKK02340 ([gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATGAATCCCCCTTTAGA,  downstream forward: _UP4_TAGAAAAAAAGAACACCTCA
MDB52 ([gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]::cat trpC2 pheA1 available in [wiki|Erhard Bremer]'s and [wiki|Jörg Stülke]'s labs [Pubmed|25344233]
References
7751298,21821766,24013209,25344233,30666812,33481774

622856EE642C42247C658DBD57E6A18C6E81FE58

Page visits: 2819

Time of last update: 2022-12-01 09:27:49

Author of last update: Jstuelk