yfkA

yfkA
168

putative Fe-S oxidoreductase, affects the level of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp] modification

locus
BSU_07955
Molecular weight
43.00 kDa
pI
5.923
Protein length
Gene length
function
control of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp] modification
product
putative Fe-S oxidoreductase
essential
no
synonyms
yfkA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0535

This gene is a member of the following regulons

Gene
Coordinates
868,007  869,128
Phenotypes of a mutant
inactivation suppresses the swarming defect of a [gene|248F0805272FED9B38ECBB31E2872BC9EC163CE0|ymfI] mutant [pubmed|29615499]
The protein
Protein family
[wiki|Radical SAM superfamily] (according to UniProt)
[wiki|Cofactors]
Fe-S cluster [pubmed|29292548]
Structure
[AF|O34400]
Expression and Regulation
Operons
genes
[gene|62718BBECEB18244B5CC877509679F5F9A0C50CD|yfkA]-[gene|5ACE71EBBDCEB0C534A91DE303FD8069BEFDD6A1|yfkC]
description
[Pubmed|22383849]
Open in new tab

[gene|62718BBECEB18244B5CC877509679F5F9A0C50CD|yfkA]→[gene|5ACE71EBBDCEB0C534A91DE303FD8069BEFDD6A1|yfkC]

2022-11-30 23:48:54

ghost

22

0268bfc04b424f60bea9d4d1f428b25ab4988899

E46E01052075C80D99DCD7C9F6F0FD0CDC2D2DAB

Biological materials
Mutant
MGNA-C348 (yfkA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2346 NBRP B. subtilis, Japan]
BKE07955 ([gene|62718BBECEB18244B5CC877509679F5F9A0C50CD|yfkA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07955 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACTATCTAACTCCTTT,  downstream forward: _UP4_TAGATGCGGATGAAAGAAAC
BKK07955 ([gene|62718BBECEB18244B5CC877509679F5F9A0C50CD|yfkA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07955 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACTATCTAACTCCTTT,  downstream forward: _UP4_TAGATGCGGATGAAAGAAAC
References
22383849,29615499

62718BBECEB18244B5CC877509679F5F9A0C50CD

Page visits: 1236

Time of last update: 2022-11-27 12:18:20

Author of last update: Jstuelk