tagU

tagU
168

phosphotransferase, attaches teichoic acid, teichuronic acid, or acidic capsular polysaccharide to cell wall peptidoglycan via phosphodiester linkage to N-acteylmuramic acid

locus
BSU_35650
Molecular weight
34.43 kDa
pI
9.53
Protein length
Gene length
function
transfer of anionic cell wall polymers from lipid-linked precursors to peptidoglycan
product
phosphotransferase, responsible for attachment of anionic polymers to peptidoglycan
essential
no
synonyms
tagU, lytR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1316

This gene is a member of the following regulons

Gene
Coordinates
3,663,281  3,664,201
Phenotypes of a mutant
a ''[gene|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU]'' mutant has no phenoype, the triple ''[gene|68FE85BAA457199D34C9068F38756972CD2D280D|tagT] [gene|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU] [gene|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|tagV]'' mutant is unable to grow under normal conditions [Pubmed|21964069]
The protein
Protein family
LytR/CpsA/Psr (LCP) family (with [protein|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|tagV] and [protein|68FE85BAA457199D34C9068F38756972CD2D280D|tagT], according to UniProt)  [Pubmed|19099556]
[wiki|Cofactors]
Mg2+ [Pubmed|29107701,21964069]
Structure
[PDB|6UF6] (aa 62-306) [pubmed|31969390]
[PDB|3MEJ] ([protein|68FE85BAA457199D34C9068F38756972CD2D280D|tagT], 36% identity, 69% similarity)
[AF|Q02115]
Paralogous protein(s)
[protein|68FE85BAA457199D34C9068F38756972CD2D280D|tagT], [protein|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|tagV]
[wiki|Localization]
cytoplasmic membrane (with extracytoplasmic catalaytic domain) [Pubmed|21964069]
Expression and Regulation
Operons
genes
[gene|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU]
description
[Pubmed|1357079]
regulatory mechanism
[protein|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU]: auto-repression, [Pubmed|1357079], in [regulon|protein:62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1357079,9636707], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|19047346], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|1357079,9636707], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab

[gene|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU]

2022-05-15 18:15:09

ghost

10

301880fead9038d82a4599ff7c0b916a16096d36

269D1DC80BE562890C38D43998F0B2A100ADC9B3

additional information
the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
Biological materials
Mutant
BKE35650 ([gene|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTTTGCACCTCGTCTG,  downstream forward: _UP4_TAAAACAAAAAGAAGCTTCG
BKK35650 ([gene|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTTTGCACCTCGTCTG,  downstream forward: _UP4_TAAAACAAAAAGAAGCTTCG
References
Reviews
24024634
Original Publications
9636707,1357079,19099556,21964069,26883633,29107701,31969390

62A3CC548E033A45F94FE4386EE29711A6A14C6B

Page visits: 3023

Time of last update: 2022-06-23 09:48:03

Author of last update: Jstuelk