SubtiWiki SubtiWiki
alaT

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

alaT
168

PLP-dependent L-alanine aminotransferase

locus
BSU_31400
Molecular weight
42.15 kDa
pI
5.11
Protein length
Gene length
function
biosynthesis of L-alanine
product
PLP-dependent L-alanine aminotransferase
essential
no
synonyms
alaT, yugH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0436

This gene is a member of the following regulons

Gene
Coordinates
3,225,772  3,226,932
Phenotypes of a mutant
strongly impaired growth in the absence of alanine [pubmed|33155333]
a [gene|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|alaT] [gene|38989B6CB025AE110709E2EA2025EFD425328FFA|dat] double mutant is auxotrophic for alanine [pubmed|33155333]
The protein
Catalyzed reaction/ biological activity
pyruvate + glutamate --> L-alanine + 2-oxoglutarate [pubmed|33155333]
Protein family
[wiki|class-I pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
Structure
[PDB|1DJU] (from ''Pyrococcus horikoshii'', 47% identity) [Pubmed|10671523]
Paralogous protein(s)
[protein|AE802E1D4F827DED3A5D953C7D034E6A3554C45F|aspB], [protein|094AE3AC8DFAFC8048ADAAB34F76DF2562D80CE7|patA]
Expression and Regulation
Operons
genes
[gene|1CA87275AFA1B4E4B5E8E10229009F785E70BBA8|alaR]-[gene|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|alaT]
description
[Pubmed|22383849]
additional information
A [protein|search|ncRNA] is predicted between [gene|B0908BB4B8B569A7A78BB0B84784FD4C427C598B|yugI] and [gene|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|alaT] [PubMed|20525796]
Open in new tab

[gene|1CA87275AFA1B4E4B5E8E10229009F785E70BBA8|alaR]→[gene|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|alaT]

2021-12-04 13:55:15

Jstuelk

12

9d6558c6d1956815b49569180a4013bc92457db5

6BFC2A870201FAF01E264D2DE76E294B4D2167A2

Biological materials
Mutant
GP3594 (Δ[gene|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|alaT]::''phleo''), available in [wiki|Jörg Stülke]'s lab
GP3575 (Δ[gene|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|alaT]::''kan''), available in [wiki|Jörg Stülke]'s lab
MGNA-A621 (yugH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/621 NBRP B. subtilis, Japan]
BKE31400 ([gene|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|alaT]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31400 BGSC] and in [wiki|Jörg Stülke]'s lab,  [Pubmed|28189581], upstream reverse: _UP1_ATAGTCTGATAAATACGAAG,  downstream forward: _UP4_TAAAAAAAGATACGAACCTT
BKK31400 ([gene|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|alaT]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31400 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATAGTCTGATAAATACGAAG,  downstream forward: _UP4_TAAAAAAAGATACGAACCTT
References
20525796,22383849,10671523,33155333

62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021

Page visits: 1646

Time of last update: 2022-01-19 05:14:28

Author of last update: MBenda