pbuO

pbuO
168

similar to hypoxanthine/guanine permease [protein|41DDD3AAFE89D0F52AB5ABD08CEE30A1767FFD7A|pbuG]

locus
BSU_29990
Molecular weight
45.26 kDa
pI
7.48
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
pbuO, ytiP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2252

This gene is a member of the following regulons

Gene
Coordinates
3,068,908  3,070,206
The protein
Protein family
[wiki|xanthine/uracil permease family] (according to UniProt)
Structure
[AF|O34978]
Paralogous protein(s)
[protein|41DDD3AAFE89D0F52AB5ABD08CEE30A1767FFD7A|pbuG]
Expression and Regulation
Operons
genes
[gene|62AC66725C55B9E5FBBEB4EC43A88F7081B74D5C|pbuO]
description
[Pubmed|9387221]
regulation
repressed in the presence of purine nucleotides ([protein|search|PurR]) [Pubmed|11591660,2536750]
regulatory mechanism
[protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]: repression, (molecular inducer: PRPP) [Pubmed|11591660,2536750], in [regulon|protein:A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR regulon]
Open in new tab

[gene|62AC66725C55B9E5FBBEB4EC43A88F7081B74D5C|pbuO]

2022-11-22 00:30:30

ghost

20

d5c4ba27f66adc2923876e97ba46f55e833a1d2c

DEA2993DDD3169D023F0E923E109953E3B562752

Biological materials
Mutant
MGNA-A819 (ytiP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/819 NBRP B. subtilis, Japan]
BKE29990 ([gene|62AC66725C55B9E5FBBEB4EC43A88F7081B74D5C|pbuO]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGTATCCTCCAATTACG,  downstream forward: _UP4_TAAGGATAGACCAAAAAACC
BKK29990 ([gene|62AC66725C55B9E5FBBEB4EC43A88F7081B74D5C|pbuO]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGTATCCTCCAATTACG,  downstream forward: _UP4_TAAGGATAGACCAAAAAACC
References
11591660,2536750,9387221

62AC66725C55B9E5FBBEB4EC43A88F7081B74D5C

Page visits: 1514

Time of last update: 2022-12-01 19:02:31

Author of last update: Melvin.boenninger