

stress-responsive membrane protease

Molecular weight
32.71 kDa
Protein length
Gene length
quality control of membrane proteins
membrane protease
htpX, ykrL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0501

This gene is a member of the following regulons

1,414,997  1,415,893
Phenotypes of a mutant
increased sensitivity to membrane protein overproduction [Pubmed|22447908]
increased sensitivity to dissipation of the membrane potential by the addition of valinomycin [Pubmed|22447908]
The protein
Protein family
Peptidase M48B family (with [protein|4B54FF77FD5B6E22D6EF3DBECD9B84C0B5A60E18|yhfN], according to UniProt)
[PDB|3CQB] (from Vibrio parahaemolyticus, corresponds to aa 71 ... 173, 45% identity)
cell membrane (according to UniProt)
Expression and Regulation
expression is increased due to mutations in ''[protein|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]'', ''[protein|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]'', ''[protein|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]'', and'' [protein|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]'' [Pubmed|22447908]
regulatory mechanism
[protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]: repression, [Pubmed|22447908], in [regulon|protein:1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok regulon]
Open in new tab


2022-12-29 12:50:02





additional information
the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
Biological materials
MGNA-B316 (ykrL::erm), available at the [ NBRP B. subtilis, Japan]
BKE13490 ([gene|62B6875301B458F04E3F65717AD3A5925A9C4973|htpX]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACAACCTCCGTTATTT,  downstream forward: _UP4_TAATACAAACACATTGTTCC
BKK13490 ([gene|62B6875301B458F04E3F65717AD3A5925A9C4973|htpX]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACAACCTCCGTTATTT,  downstream forward: _UP4_TAATACAAACACATTGTTCC
Original Publications


Page visits: 1974

Time of last update: 2023-02-02 14:24:45

Author of last update: Jstuelk