SubtiWiki SubtiWiki
ahrC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ahrC
168

transcriptional regulator of the ArgR family, AhrC represses the genes for arginine biosynthesis and activates the genes for arginine catabolism

locus
BSU_24250
Molecular weight
16.69 kDa
pI
5.52
Protein length
Gene length
function
transcriptional regulator of arginine metabolic genes
product
transcriptional regulator (ArgR family)
essential
no
synonyms
ahrC, argR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1438

This gene is a member of the following regulons

Gene
Coordinates
2,522,324  2,522,773
Phenotypes of a mutant
increased intracellular concentration of ornithine, citrulline, and arginine [pubmed|28679749]
[gene|search|ahrC ]inactivation allows growth of a [gene|search|ktrA ][gene|search|ktrB ][gene|search|kimA ]mutant at low potassium concentration [pubmed|28679749]
The protein
Catalyzed reaction/ biological activity
transcriptional activator/ repressor of genes involved in arginine metabolism
Protein family
ArgR family (single member, according to UniProt)
[wiki|Cofactors]
L-arginine is the co-factor required for transcription repression/ activation
Structure
[PDB|2P5L] (complex with an 18bp DNA operator) [pubmed|18455186]
[PDB|2P5K] (N-terminus) [pubmed|18007039]
[PDB|2P5M] (C-Terminus) [pubmed|18007040]
[PDB|1F9N] [pubmed|11856827]
[wiki|Localization]
Cytoplasm
Expression and Regulation
Operons
genes
[gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]-[gene|5680A06A74D3EC6310EF8677795511C75DB3059E|recN]
description
[Pubmed|2106508]
regulation
by [protein|search|sRNA] [protein|search|sr1]
additional information
expression is fourfold increased upon depletion of ''[wiki|nusA]'' [http://www.nature.com/articles/nmicrobiol20157 Reference]
Open in new tab

[gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]→[gene|5680A06A74D3EC6310EF8677795511C75DB3059E|recN]

2021-09-18 05:53:02

ghost

11

cd9e4583995139b45dec8ee7a4f468ed7762fec6

18832E313ED1EB02E9A9AEB9ED804FDAE6EBBAAD

genes
[gene|EA9FCF84AE4FA80993566B62A9200D4B32AF5670|dxs]-[gene|923C4177500E9678A0B4855F8F481D4A36ECD863|yqxC]-[gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]-[gene|5680A06A74D3EC6310EF8677795511C75DB3059E|recN]
description
[pubmed|22383849]
regulation
[protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
regulatory mechanism
stringent response: negative regulation, [pubmed|11948165], in [regulon|other_regulator:stringent response|stringent response]
Open in new tab

[gene|EA9FCF84AE4FA80993566B62A9200D4B32AF5670|dxs]->[gene|5680A06A74D3EC6310EF8677795511C75DB3059E|recN]

2021-09-21 18:34:50

Bzhu

8

b0947a7d3105a0852956b3f944c4db191022c978

B8B8483360C3BE8FDAC3C4C5B3BC2ECD2877E42D

Other regulations
[protein|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]: translation inhibition
additional information
the [gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1] RNA controls [gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC] expression via binding to the [gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC] mRNA, binding is enhanced by [gene|93F328524989597C7D2329B25E665496C9631E87|csrA] [pubmed|31043113]
Biological materials
Mutant
GP729 (''Δ''''[gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]''::''aphA3''), available in [wiki|Jörg Stülke]'s lab
GP3122 (''Δ''''[gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]''::''phleo''), available in [wiki|Jörg Stülke]'s lab
GP2185 (''Δ''''[gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]''::''ermC''), available in [wiki|Jörg Stülke]'s lab [pubmed|28679749]
BKE24250 ([gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAGCACCTCTATTTC,  downstream forward: _UP4_TAACAGAAAATCTAACAAAG
BKK24250 ([gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAGCACCTCTATTTC,  downstream forward: _UP4_TAACAGAAAATCTAACAAAG
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Simon Phillips], Leeds University, UK [http://www.astbury.leeds.ac.uk/People/staffpage.php?StaffID=SEVP Homepage]
[wiki|Michel Debarbouille], Pasteur Institute, Paris, France [http://www.pasteur.fr/ip/easysite/go/03b-00000m-0ob/recherche/departements-scientifiques/microbiologie/unites-et-groupes/unite-de-biologie-des-bacteries-pathogenes-a-gram-positif/les-membres-de-l-equipe Homepage]
References
Reviews
34160574
Original Publications
17020585,17576690,18455186,18007040,18007039,11856827,11305941,9383188,7565595,1312212,2106508,27171430,28679749,31043113,32397647

62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4

Page visits: 4057

Time of last update: 2021-09-23 04:27:29

Author of last update: Jstuelk