proG

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

proG
168

1-pyrroline-5-carboxylate dehydrogenase

locus
BSU_12910
Molecular weight
30.05 kDa
pI
4.91
Protein length
Gene length
function
biosynthesis of proline
product
1-pyrroline-5-carboxylate dehydrogenase
essential
no
ec
1.5.1.2
synonyms
proG, ykeA, yzcA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0345

This gene is a member of the following regulons

Gene
Coordinates
1,359,454  1,360,272
The protein
Catalyzed reaction/ biological activity
1-pyrroline-5-carboxylate + NADPH + H+ --> L-proline + NADP+ [pubmed|28824574]
L-proline + NADP+ --> 1-pyrroline-5-carboxylate + 2 H+ + NADPH (according to UniProt)
L-proline + NAD+ --> 1-pyrroline-5-carboxylate + 2 H+ + NADH (according to UniProt)
Protein family
[wiki|pyrroline-5-carboxylate reductase family] [pubmed|28824574]
[wiki|Cofactors]
NADPH [pubmed|28824574]
Structure
[AF|Q00777]
Effectors of protein activity
feedback-inhibited by proline [pubmed|28824574]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|63AFCEE5DEA6B2604C02592C5FB52EDFAE68913E|proG]
description
[Pubmed|1766370,21784929]
Open in new tab

[gene|63AFCEE5DEA6B2604C02592C5FB52EDFAE68913E|proG]

2022-04-26 10:40:56

ghost

10

9563c62cb2cad4c9ca6a9ab4e852ff9e03d4e54e

B0D5771A0099742E0C49412813CA2447B0B2EC65

Biological materials
Mutant
MGNA-B308 (ykeA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1307 NBRP B. subtilis, Japan]
BKE12910 ([gene|63AFCEE5DEA6B2604C02592C5FB52EDFAE68913E|proG]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12910 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGACTCAGTCCTTTCAT,  downstream forward: _UP4_TGAATCCTTGAAAGAGGATT
BKK12910 ([gene|63AFCEE5DEA6B2604C02592C5FB52EDFAE68913E|proG]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12910 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGACTCAGTCCTTTCAT,  downstream forward: _UP4_TGAATCCTTGAAAGAGGATT
References
Reviews
25367752
Original Publications
11418582,1766370,21784929,28752945,28824574

63AFCEE5DEA6B2604C02592C5FB52EDFAE68913E

Page visits: 886

Time of last update: 2022-05-17 15:30:31

Author of last update: Melvin.boenninger