ypzA

ypzA
168

unknown

locus
BSU_21950
Molecular weight
9.92 kDa
pI
4.05
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ypzA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5895

This gene is a member of the following regulons

Gene
Coordinates
2,308,495  2,308,764
The protein
Structure
[AF|O32007]
Expression and Regulation
Operons
genes
[gene|6452C3EE9644BD462E675DEE95D1683D47EEF4A4|ypzA]
description
[Pubmed|22383849]
regulation
expressed late during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]) [Pubmed|15699190,16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|6452C3EE9644BD462E675DEE95D1683D47EEF4A4|ypzA]

2022-12-21 22:08:04

Jstuelk

12

b299d72f9b6393b71491bff9b0589e7eecb0ef7e

7DD9B0935EF8B87B026E717CA79F3424766548CF

Biological materials
Mutant
MGNA-A873 (ypzA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/873 NBRP B. subtilis, Japan]
BKE21950 ([gene|6452C3EE9644BD462E675DEE95D1683D47EEF4A4|ypzA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE21950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAAAAAACACCTCCGCCA,  downstream forward: _UP4_TAAAAACCGCAGCTTCTGCG
BKK21950 ([gene|6452C3EE9644BD462E675DEE95D1683D47EEF4A4|ypzA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK21950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAAAAAACACCTCCGCCA,  downstream forward: _UP4_TAAAAACCGCAGCTTCTGCG
References
15699190,16497325

6452C3EE9644BD462E675DEE95D1683D47EEF4A4

Page visits: 871

Time of last update: 2023-01-23 08:38:39

Author of last update: Melvin.boenninger