ybaK

ybaK
168

sporulation protein

locus
BSU_01520
Molecular weight
17.51 kDa
pI
5
Protein length
Gene length
function
unknown
product
sporulation protein
essential
no
ec
null
synonyms
ybaK, ybxH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5870

This gene is a member of the following regulons

Gene
Coordinates
156,109  156,552
The protein
Structure
[AF|P50862]
Expression and Regulation
Operons
genes
[gene|64786CC240BC208571AA3B3D28B5167FEF8CD428|ybaK]-[gene|B09FB626274B81F00A4FB42D188E089095343182|cwlD]
description
[Pubmed|7559346]
regulation
expressed during sporulation ([protein|search|SigG]) [Pubmed|7559346]
regulatory mechanism
[protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]: repression, [Pubmed|16267290], in [regulon|protein:D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,7559346], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|64786CC240BC208571AA3B3D28B5167FEF8CD428|ybaK]→[gene|B09FB626274B81F00A4FB42D188E089095343182|cwlD]

2023-01-19 14:20:39

ghost

41

4f94f75e692055c74b40e3a962d570a6ee8c5661

383CCC0DCD3BEF5EE74EDF98931A9661F9EE0C1D

Biological materials
Mutant
BKE01520 ([gene|64786CC240BC208571AA3B3D28B5167FEF8CD428|ybaK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATAAATTCACTCTCCTT,  downstream forward: _UP4_TAATCATATTTCCCGACCCT
BKK01520 ([gene|64786CC240BC208571AA3B3D28B5167FEF8CD428|ybaK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATAAATTCACTCTCCTT,  downstream forward: _UP4_TAATCATATTTCCCGACCCT
References
7559346,16267290

64786CC240BC208571AA3B3D28B5167FEF8CD428

Page visits: 1475

Time of last update: 2023-02-05 20:52:40

Author of last update: Bzhu