pksB

pksB
168

involved in polyketide synthesis

locus
BSU_17090
Molecular weight
25.76 kDa
pI
6.59
Protein length
Gene length
function
polyketide synthesis
product
unknown
essential
no
synonyms
pksB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0491

This gene is a member of the following regulons

Gene
Coordinates
1,782,713  1,783,390
The protein
Protein family
[wiki|metallo-beta-lactamase superfamily] (according to UniProt)
Structure
[PDB|4YSB] (from Myxococcus xanthus, 28% identity) [pubmed|26082492]
[AF|O34769]
Expression and Regulation
Operons
genes
[gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]-[gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]-[gene|F3E9CA9330394FD829D59B0C2D4D1EEDD2C22D3B|pksD]-[gene|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE]-[gene|6BEC9E2BCECE33803EAC14DE7E8E988FC9C8DC8B|acpK]-[gene|85D6E439529E8B3F73244A0B004B394B4FE65509|pksF]-[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]-[gene|A4CF68F602273CFDFD55EFD2C1164F0E2E8F6972|pksH]-[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]-[gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]-[gene|BABBC5848F9BBF9E9318252F5AD7D1C4F55FCEAB|pksL]-[gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]-[gene|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|pksN]-[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]
description
[pubmed|22383849]
Open in new tab

[gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]→[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]

2022-11-25 15:41:08

Jstuelk

58

c851e07b7201353cf026d8929ea66cff6bbb92e2

D95CF77A7673AA84CC653095A1FB017D490049D6

Biological materials
Mutant
BKE17090 ([gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE17090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTATACCATCCCTATCA,  downstream forward: _UP4_TAATCCTTCTGAATCTATTA
BKK17090 ([gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK17090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTATACCATCCCTATCA,  downstream forward: _UP4_TAATCCTTCTGAATCTATTA
References
Research papers
26082492

647B1D7E496E81E7FC7FD2BDCACC2486852BAC19

Page visits: 1184

Time of last update: 2022-12-01 16:13:00

Author of last update: Jstuelk