pdxS

pdxS
168

pyridoxal-5-phosphate synthase (synthase domain)

locus
BSU_00110
Molecular weight
31.46 kDa
pI
5.09
Protein length
Gene length
function
pyridoxal-5-phosphate biosynthesis
product
pyridoxal-5-phosphate synthase (synthase domain)
essential
no
ec
4.3.3.6
synonyms
pdxS, yaaD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0214

This gene is a member of the following regulons

Gene
Coordinates
19,062 19,946
Phenotypes of a mutant
auxotrophic for pyridoxal 5'-phosphate [Pubmed|14762015]
inactivation of [gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS] reduces sporulation efficiency to 1.2% that of wild type cells [Pubmed|26735940]
poor growth [pubmed|28189581]
non-transformable [pubmed|28189581]
The protein
Catalyzed reaction/ biological activity
Catalyzes the formation of pyridoxal 5'-phosphate from ribose 5-phosphate (RBP), glyceraldehyde 3-phosphate (G3P) and ammonia. The ammonia is provided by the [protein|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT] subunit. (according to UniProt)
aldehydo-D-ribose 5-phosphate + D-glyceraldehyde 3-phosphate + L-glutamine --> H+ + 3 H2O + L-glutamate + phosphate + pyridoxal 5'-phosphate (according to UniProt)
Protein family
PdxS/SNZ family (single member, according to UniProt)
Structure
[PDB|2NV2] [protein|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[protein|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT] complex [Pubmed|17159152]
[PDB|2NV1] [protein|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS] [Pubmed|17159152]
[AF|P37527]
Modification
phosphorylated on Arg-8 [Pubmed|22517742]
phosphorylated on STY [Pubmed|16493705], [Pubmed|17726680]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA]-[gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT]-[gene|82B92D2FB8DB88689D3A8B77FAD2F63FCCA04C7E|serS]
description
[Pubmed|22383849]
regulation
the leader mRNA is processed upstream of [gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ylbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT] complex [Pubmed|29794222]
Open in new tab

[gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA]→[gene|82B92D2FB8DB88689D3A8B77FAD2F63FCCA04C7E|serS]

2022-12-05 04:43:51

Jstuelk

58

4760e1ef503f91543fe562a8e6f81fd9fdcc9c0c

59F563C38B7236ABF3A723D4A694F254F7E01503

genes
[gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT]
description
[Pubmed|22383849]
regulation
negatively controlled by [wiki|Spo0A] [Pubmed|14651647]
expression is reduced in motile cells as compared to non-motile cells [pubmed|33782055]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]: repression, [pubmed|34967415], in [regulon|protein:A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR regulon]
Open in new tab

[gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]→[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT]

2022-11-28 15:26:03

Jstuelk

54

63B65B6A7D02DD2F0342EA206857EBB49F7FB19B

F34D4064CCD22AF4406311F14053515BAC721AB2

genes
[gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT]-[gene|82B92D2FB8DB88689D3A8B77FAD2F63FCCA04C7E|serS]
description
[Pubmed|22383849]
Open in new tab

[gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]→[gene|82B92D2FB8DB88689D3A8B77FAD2F63FCCA04C7E|serS]

2022-12-01 06:50:06

Jstuelk

55

3a39773e030831d4f4c2ea2177325068c250716a

FEDBE769AE13F9FC0C403044E49C379680B12566

Biological materials
Mutant
BKE00110 ([gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTGGTCCCCCTAAT, downstream forward: _UP4_TAAGAACATAGGAGCGCTGC
BKK00110 ([gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTGGTCCCCCTAAT, downstream forward: _UP4_TAAGAACATAGGAGCGCTGC
BV604 (([gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT])::tet), available in [wiki|Fabian Commichau]'s lab, [Pubmed|24972371]
BP1100 (([gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT])::tet trp+), available in [wiki|Jrg Stlke]'s and [wiki|Fabian Commichau]'s labs
References
Reviews
33665688
Original Publications
15911615,14762015,25473090,14651647,17726680,16493705,16030023,19152323,17159152,22517742,15378759,25568319,26490441,16233205,28189581,33559288,33782055,34967415

651D1E534490276B9BE7BFE7B5819176AE09891E

Page visits: 3223

Time of last update: 2022-12-06 01:14:11

Author of last update: Jstuelk