

pyridoxal-5-phosphate synthase (synthase domain)

Molecular weight
31.46 kDa
Protein length
Gene length
pyridoxal-5-phosphate biosynthesis
pyridoxal-5-phosphate synthase (synthase domain)
pdxS, yaaD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0214 (Galperin et al., 2021)

This gene is a member of the following regulons

19,062 19,946
Phenotypes of a mutant
the mutant tends to acquire suppressor mutations that result in improved growth and colony morphology [Pubmed|28189581]
auxotrophic for pyridoxal 5'-phosphate [Pubmed|14762015]
inactivation of [gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS] reduces sporulation efficiency to 1.2% that of wild type cells [Pubmed|26735940]
poor growth [pubmed|28189581]
non-transformable [pubmed|28189581]
The protein
Catalyzed reaction/ biological activity
Catalyzes the formation of pyridoxal 5'-phosphate from ribose 5-phosphate (RBP), glyceraldehyde 3-phosphate (G3P) and ammonia. The ammonia is provided by the [protein|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT] subunit. (according to UniProt)
aldehydo-D-ribose 5-phosphate + D-glyceraldehyde 3-phosphate + L-glutamine --> H+ + 3 H2O + L-glutamate + phosphate + pyridoxal 5'-phosphate (according to UniProt)
Protein family
PdxS/SNZ family (single member, according to UniProt)
[PDB|2NV2] [protein|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[protein|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT] complex [Pubmed|17159152]
[PDB|2NV1] [protein|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS] [Pubmed|17159152]
phosphorylated on Arg-8 [Pubmed|22517742]
phosphorylated on STY [Pubmed|16493705], [Pubmed|17726680]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
the leader mRNA is processed upstream of [gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ricA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ricF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|ricT] complex [Pubmed|29794222]
Open in new tab


2024-02-17 02:33:46





negatively controlled by [wiki|Spo0A] [Pubmed|14651647]
expression is reduced in motile cells as compared to non-motile cells [pubmed|33782055]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]: repression, [pubmed|34967415], in [regulon|protein:A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR regulon]
Open in new tab


2024-02-25 17:18:52





Open in new tab


2024-01-17 18:42:51





Biological materials
BKE00110 ([gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTGGTCCCCCTAAT, downstream forward: _UP4_TAAGAACATAGGAGCGCTGC
BKK00110 ([gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTGGTCCCCCTAAT, downstream forward: _UP4_TAAGAACATAGGAGCGCTGC
BV604 (([gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT])::tet), available in [wiki|Fabian Commichau]'s lab, [Pubmed|24972371]
BP1100 (([gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT])::tet trp+), available in [wiki|Jrg Stlke]'s and [wiki|Fabian Commichau]'s labs
Original Publications


Page visits: 4238

Time of last update: 2024-02-25 15:23:30

Author of last update: Jstuelk