

polymorphic LXG toxin, non-specific metal-dependent DNase

Molecular weight
74.00 kDa
Protein length
Gene length
competetion with other bacteria in biofilms
LXG toxin, non-specific metal-dependent DNase

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5444 (Galperin et al., 2021)

This gene is a member of the following regulons

747,554  749,563
Phenotypes of a mutant
the mutant is outcompeted by wild type cells in biofilms [pubmed|34280190]
The protein
Catalyzed reaction/ biological activity
non-specific metal-dependent DNase activity [pubmed|32117125]
[wiki|LXG domain] (aa 1-235) (according to UniProt)
secretion and delivery requires [protein|50D2A03E2D7B5D461540FD157377E0D37F771888|WXG100] and the T7SS ([protein|3CC3E197848E9688413C15CEA7DDCF0A7120A920|yukD]-[protein|3FE4A91C7D0B43C8704391F2F9493852B3AED9B0|essB]-[wiki|YukB]-[wiki|YueB]-[wiki|YueC]-[protein|B258CA26B0EC2310475FCCD67F1F196857FC0004|yueD]) [pubmed|34280190]
Expression and Regulation
Open in new tab


2024-02-15 03:52:53





Biological materials
MGNA-A963 (yeeF::erm), available at the [ NBRP B. subtilis, Japan]
BKE06812 ([gene|655C07294D3A04763049D6701A7296BB4AF8E6B9|yeeF]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACCATTTCCCTTCTTT,  downstream forward: _UP4_TAGAAGAATGGAAACTAGGA
BKK06812 ([gene|655C07294D3A04763049D6701A7296BB4AF8E6B9|yeeF]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACCATTTCCCTTCTTT,  downstream forward: _UP4_TAGAAGAATGGAAACTAGGA


Page visits: 3111

Time of last update: 2024-02-25 02:15:57

Author of last update: Jstuelk