yeeF

yeeF
168

polymorphic LXG toxin, non-specific metal-dependent DNase

locus
BSU_06812
Molecular weight
74.00 kDa
pI
8.942
Protein length
Gene length
function
competetion with other bacteria in biofilms
product
LXG toxin, non-specific metal-dependent DNase
essential
no
ec
null
synonyms
yeeF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5444

This gene is a member of the following regulons

Gene
Coordinates
747,554  749,563
Phenotypes of a mutant
the mutant is outcompeted by wild type cells in biofilms [pubmed|34280190]
The protein
Catalyzed reaction/ biological activity
non-specific metal-dependent DNase activity [pubmed|32117125]
[wiki|Domains]
[wiki|LXG domain] (aa 1-235) (according to UniProt)
Structure
[AF|O31506]
[wiki|Localization]
secreted
secretion and delivery requires [protein|50D2A03E2D7B5D461540FD157377E0D37F771888|WXG100] and the T7SS ([protein|3CC3E197848E9688413C15CEA7DDCF0A7120A920|yukD]-[protein|3FE4A91C7D0B43C8704391F2F9493852B3AED9B0|essB]-[wiki|YukB]-[wiki|YueB]-[wiki|YueC]-[protein|B258CA26B0EC2310475FCCD67F1F196857FC0004|yueD]) [pubmed|34280190]
Expression and Regulation
Operons
genes
[gene|655C07294D3A04763049D6701A7296BB4AF8E6B9|yeeF]-[gene|9202D58FAC1B7B9CF693D537A12C683A3573B17E|yezG]
description
[pubmed|22383849]
Open in new tab

[gene|655C07294D3A04763049D6701A7296BB4AF8E6B9|yeeF]→[gene|9202D58FAC1B7B9CF693D537A12C683A3573B17E|yezG]

2022-11-27 14:09:56

Jstuelk

36

5bb08af70401c565fbdae5d982125690b459f19e

9E0FA7FA455D9ED27A76FB20F9CB02D7B8BCC6B8

Biological materials
Mutant
MGNA-A963 (yeeF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/963 NBRP B. subtilis, Japan]
BKE06812 ([gene|655C07294D3A04763049D6701A7296BB4AF8E6B9|yeeF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE06812 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACCATTTCCCTTCTTT,  downstream forward: _UP4_TAGAAGAATGGAAACTAGGA
BKK06812 ([gene|655C07294D3A04763049D6701A7296BB4AF8E6B9|yeeF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK06812 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACCATTTCCCTTCTTT,  downstream forward: _UP4_TAGAAGAATGGAAACTAGGA
References
22200572,32117125,34280190,36154281

655C07294D3A04763049D6701A7296BB4AF8E6B9

Page visits: 1612

Time of last update: 2022-11-28 22:28:12

Author of last update: Jstuelk