ydfR

ydfR
168

unknown

locus
BSU_05530
Molecular weight
25.02 kDa
pI
10.37
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ydfR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2323

This gene is a member of the following regulons

Gene
Coordinates
600,229  600,906
The protein
Protein family
[wiki|UPF0702 family] (according to UniProt)
Structure
[AF|P96696]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|65EAA88A18FD7E11ED7ACAF8026E088ACD9EA303|ydfR]
description
[Pubmed|16497325]
regulation
expressed during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]) [Pubmed|16497325]
strongly expressed during oligotrophic growth [pubmed|30792386]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|65EAA88A18FD7E11ED7ACAF8026E088ACD9EA303|ydfR]

2023-02-05 21:51:00

Jstuelk

19

943f42c08e15b4d15256fa29bfdad5c88777a1b6

3E1E4F07B55D1CC6D6A958C98A58237E267A48AB

Biological materials
Mutant
MGNA-C155 (ydfR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2153 NBRP B. subtilis, Japan]
BKE05530 ([gene|65EAA88A18FD7E11ED7ACAF8026E088ACD9EA303|ydfR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTGTCCTGAACCGAAC,  downstream forward: _UP4_TAACAAAAGGCGCTTGTGGC
BKK05530 ([gene|65EAA88A18FD7E11ED7ACAF8026E088ACD9EA303|ydfR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTGTCCTGAACCGAAC,  downstream forward: _UP4_TAACAAAAGGCGCTTGTGGC
References
16497325,30792386

65EAA88A18FD7E11ED7ACAF8026E088ACD9EA303

Page visits: 1241

Time of last update: 2023-02-05 22:29:17

Author of last update: Melvin.boenninger