

lichenan-specific permease of the [wiki|phosphotransferase systems|phosphotransferase system], EIIB of the [category|SW.1.2.2|PTS], [category|SW.3.4.3|Trigger enzyme], control of [protein|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR] activity

Molecular weight
10.82 kDa
Protein length
Gene length
lichenan uptake and phosphorylation, control of LicR activity
lichenan-specific [category|SW.1.2.2|PTS], EIIB component
licB, celA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1440

This gene is a member of the following regulons

3,961,566  3,961,874
The protein
Protein family
[category|SW.1.2.2|PTS] permease, lactose family [Pubmed|10627040]
[wiki|PTS EIIB domain] type-3 (aa 1-102) (according to UniProt)
[PDB|1e2b] (from ''E. coli'', 40% identity) [Pubmed|9041631]
phosphorylation on Ser-37 [Pubmed|17218307]
Paralogous protein(s)
cytoplasm (according to Swiss-Prot)
Expression and Regulation
carbon catabolite repression ([protein|search|CcpA]) [Pubmed|8990303]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|8990303], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR]: activation, [Pubmed|8990303], in [regulon|protein:E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8990303], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2022-11-25 12:14:04





Biological materials
BKE38590 ([gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAAGACCCCCTAGA,  downstream forward: _UP4_GTGTCATAGAGAGGGGCGGG
BKK38590 ([gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAAGACCCCCTAGA,  downstream forward: _UP4_GTGTCATAGAGAGGGGCGGG


Page visits: 2535

Time of last update: 2022-11-27 04:09:08

Author of last update: Melvin.boenninger