ywbO

ywbO
168

similar to disulfide oxidoreductase

locus
BSU_38250
Molecular weight
22.49 kDa
pI
4.64
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ywbO, ipa-30d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2761

This gene is a member of the following regulons

Gene
Coordinates
3,925,797  3,926,399
The protein
Structure
[PDB|5CNW] (from Deinococcus radiodurans, 34% identity)
[AF|P39598]
Expression and Regulation
Operons
genes
[gene|3985F88334D7B034A66473C5BB39188AB61A65F6|efeB]-[gene|65FC8F21D8927C231B55E8693BD29F052A830AF6|ywbO]
description
[Pubmed|18179421]
regulation
induced upon iron starvation ([protein|search|Fur]) [Pubmed|12354229]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|9683469], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab

[gene|3985F88334D7B034A66473C5BB39188AB61A65F6|efeB]→[gene|65FC8F21D8927C231B55E8693BD29F052A830AF6|ywbO]

2022-06-24 17:12:14

ghost

18

757eb214e95c0222aa8af39ef6c2953a5b252f94

7259DF3AD73DEA1EF3D0D40B16B47FC14362C226

genes
[gene|65FC8F21D8927C231B55E8693BD29F052A830AF6|ywbO]
description
[Pubmed|9353933]
Open in new tab

[gene|65FC8F21D8927C231B55E8693BD29F052A830AF6|ywbO]

2022-02-19 22:54:28

ghost

4

68109a8af5e6e26cd28f4ee2d861843a5f2596ef

B96E27D5AF9003B4B9A187E601C8B80E7A0DFF4A

Biological materials
Mutant
MGNA-B674 (ywbO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1673 NBRP B. subtilis, Japan]
BKE38250 ([gene|65FC8F21D8927C231B55E8693BD29F052A830AF6|ywbO]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATAATCTCCTTTCATA,  downstream forward: _UP4_TAAGGAAAAAGCTCTCGATA
BKK38250 ([gene|65FC8F21D8927C231B55E8693BD29F052A830AF6|ywbO]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATAATCTCCTTTCATA,  downstream forward: _UP4_TAAGGAAAAAGCTCTCGATA
References
9353933,18179421,9683469

65FC8F21D8927C231B55E8693BD29F052A830AF6

Page visits: 1158

Time of last update: 2022-06-25 10:45:07

Author of last update: Jstuelk