

export of extracellular poly-N-acetylglucosamine

Molecular weight
55.00 kDa
Protein length
Gene length
export of extracellular poly-N-acetylglucosamine
poly-N-acetylglucosamine exporter
epsK, yvfA, yvfB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2244

This gene is a member of the following regulons

3,517,485  3,519,002
Phenotypes of a mutant
smooth colonies on MsGG medium, no [wiki|biofilm formation] [Pubmed|22113911]
The EAR [wiki|RNA switch]
The protein
Protein family
[wiki|MOP exporter family]
cell membrane (according to UniProt)
Expression and Regulation
repressed by [protein|search|SinR] [Pubmed|15661000]
regulatory mechanism
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]) [Pubmed|23646920], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
EAR riboswitch: processive antitermination, in [regulon|other_regulator:EAR riboswitch|EAR riboswitch]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15661000], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
Open in new tab


2022-11-22 16:41:05





Biological materials
MGNA-B611 (yvfA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1610 NBRP B. subtilis, Japan]
BKE34265 ([gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34265 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGCGCTGAAATTTATCGTGA,  downstream forward: _UP4_AAAACGAAAGGAGCTGTGAA
BKK34265 ([gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34265 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGCGCTGAAATTTATCGTGA,  downstream forward: _UP4_AAAACGAAAGGAGCTGTGAA
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]


Page visits: 2244

Time of last update: 2022-11-26 10:01:34

Author of last update: Melvin.boenninger