SubtiWiki SubtiWiki
acsA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

acsA
168

acetyl-CoA synthetase

locus
BSU_29680
Molecular weight
64.72 kDa
pI
5.55
Protein length
Gene length
function
utilization of acetate, fatty acids
product
acetyl-CoA synthetase)
essential
no
ec
6.2.1.1
synonyms
acsA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0365

This gene is a member of the following regulons

Gene
Coordinates
3,038,213  3,039,931
The protein
Catalyzed reaction/ biological activity
acetate + ATP + CoA --> acetyl-CoA + AMP + diphosphate (according to UniProt)
Protein family
[wiki|ATP-dependent AMP-binding enzyme family] (according to UniProt)
Structure
[PDB|2P2F] (from ''Salmonella enterica'', 37% identity) [Pubmed|17497934]
Modification
acetylated on Lys-549 by [protein|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|acuA], this results in inactivation  [Pubmed|18487328], deacetylated by [protein|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN] and [protein|1255813797A83D835E0656A2AAAD361B5BB2094B|acuC] deacetylates (and thereby activates) [protein|6671E7D85E99D349679F0E9D825DC035D10FFD2E|acsA]  [Pubmed|19136592]
Paralogous protein(s)
[protein|48538F67259B25B64A7BC4263E944C7074E8E1B3|ytcI], (35,1%)
Expression and Regulation
Operons
genes
[gene|6671E7D85E99D349679F0E9D825DC035D10FFD2E|acsA]-[gene|D50593AB6035B7DFEC76867B4692B069D91DEC10|ytzK]
description
[Pubmed|22383849]
regulation
repressed by glucose (4.5-fold) ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [Pubmed|7913927,12850135]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|7913927], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12618455,18083814], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7913927], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|6671E7D85E99D349679F0E9D825DC035D10FFD2E|acsA]→[gene|D50593AB6035B7DFEC76867B4692B069D91DEC10|ytzK]

2021-09-18 05:53:21

Jstuelk

6

be092fde38a5f881d569ea0d403fca7a757675c2

47CDD5FDE201249D77E00A0FC5B0180E09236624

genes
[gene|6671E7D85E99D349679F0E9D825DC035D10FFD2E|acsA]-[gene|D50593AB6035B7DFEC76867B4692B069D91DEC10|ytzK]-[gene|EEB0CF0AF0707AC1161F150708F7EDDB749B3C42|tyrS]
description
[Pubmed|22383849]
regulation
repressed by glucose (4.5-fold) ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [Pubmed|7913927,12850135]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [pubmed|7913927], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [pubmed|12618455,18083814], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [pubmed|7913927], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|6671E7D85E99D349679F0E9D825DC035D10FFD2E|acsA]→[gene|EEB0CF0AF0707AC1161F150708F7EDDB749B3C42|tyrS]

2021-09-18 05:53:23

Jstuelk

9

64406ef718e7a3f606c729a8589083a4b11a12ee

AB9A54148FBC27339BE8203CF80C6070E696984B

Biological materials
Mutant
GP1212 (''acsA''::''kan''), available in [wiki|Jörg Stülke]'s lab
BKE29680 ([gene|6671E7D85E99D349679F0E9D825DC035D10FFD2E|acsA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCCAAACATCCCCCTT,  downstream forward: _UP4_ACAATGGAGGATTAAAAGGC
BKK29680 ([gene|6671E7D85E99D349679F0E9D825DC035D10FFD2E|acsA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCCAAACATCCCCCTT,  downstream forward: _UP4_ACAATGGAGGATTAAAAGGC
References
Reviews
15316652,31091420
Original Publications
7934817,7913927,18083814,17303131,12618455,19136592,18487328,12850135,16855235,22900538,17497934,29093482

6671E7D85E99D349679F0E9D825DC035D10FFD2E

Page visits: 2492

Time of last update: 2021-09-22 18:40:29

Author of last update: Melvin.boenninger