

polyketide synthase of type I

Molecular weight
609.00 kDa
Protein length
Gene length
polyketide synthesis
polyketide synthase of type I
pksN, pksP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4908

This gene is a member of the following regulons

1,834,409  1,850,875
The protein
Protein family
[wiki|ATP-dependent AMP-binding enzyme family] (according to UniProt)
3 [wiki|Carrier domain]s (aa 983-1058, aa 2448-2525, aa 3952-4026) (according to UniProt)
[PDB|6MHL] (from B. amyloliquefaciens, corresponds to aa 1087 ... 1687, 2557 ...3181, 4077 ... 4686)
Expression and Regulation
expressed during the transition from growth to stationary phase ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB], [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|24187085]
heterogeneous expression, percentage of expressing cells increases during colonization of plant roots [pubmed|34557426]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|24187085], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: activation, [Pubmed|24187085], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
additional information
this is a very large operon comprising about 75 kb
Open in new tab


2022-11-28 20:51:32





Open in new tab


2022-11-25 15:41:08





Biological materials
BKE17210 ([gene|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|pksN]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCTTTAAGATGTTCTT,  downstream forward: _UP4_CTGTTATAGGAGGGGAAACG
BKK17210 ([gene|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|pksN]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCTTTAAGATGTTCTT,  downstream forward: _UP4_CTGTTATAGGAGGGGAAACG


Page visits: 2131

Time of last update: 2022-12-05 19:06:03

Author of last update: Jstuelk