SubtiWiki SubtiWiki
ydhF

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ydhF
168

unknown

locus
BSU_05730
Molecular weight
26.38 kDa
pI
6.16
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ydhF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
619,321  620,031
The protein
[wiki|Domains]
[wiki|DUF4352] (aa 84 ... 190) (according to UniProt)
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862], lipid modification as retention signal
Expression and Regulation
Operons
genes
[gene|3B95AB3021280215B6B487A348D78FB5797AEEA6|phoB]-[gene|66D3E978E3DBA0410CA5597B5B860DF27C97335A|ydhF]
description
[Pubmed|10913081]
regulation
expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|9335276,10913081,16030210]
regulatory mechanism
[protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]: activation, [Pubmed|9335276,10913081,16030210], in [regulon|protein:638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,16030210], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|3B95AB3021280215B6B487A348D78FB5797AEEA6|phoB]→[gene|66D3E978E3DBA0410CA5597B5B860DF27C97335A|ydhF]

2021-11-03 14:36:22

ghost

6

cf8fae553be5c06d43c84ce2a1d3a9b12b8fcea3

B70A2379ADCCEACE613557232251C41C729E999D

Biological materials
Mutant
MGNA-C181 (ydhF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2179 NBRP B. subtilis, Japan]
BKE05730 ([gene|66D3E978E3DBA0410CA5597B5B860DF27C97335A|ydhF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05730 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGATTCCTCCATTAA,  downstream forward: _UP4_TAAATCAAGAACTCCCGTAC
BKK05730 ([gene|66D3E978E3DBA0410CA5597B5B860DF27C97335A|ydhF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05730 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGATTCCTCCATTAA,  downstream forward: _UP4_TAAATCAAGAACTCCCGTAC
References
16030210,9335276,10913081,18957862

66D3E978E3DBA0410CA5597B5B860DF27C97335A

Page visits: 1777

Time of last update: 2022-01-20 21:35:44

Author of last update: Jstuelk