ydaC

ydaC
168

similar to N-methyltransferase

locus
BSU_04180
Molecular weight
19.95 kDa
pI
9.76
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ydaC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2226

This gene is a member of the following regulons

Gene
Coordinates
470,957  471,502
The protein
Protein family
[wiki|Methyltransferase superfamily] (according to UniProt)
Structure
[PDB|4INE] (N-methyltransferase from Caenorhabditis elegans 31% identity)
[AF|P96576]
Expression and Regulation
Operons
genes
[gene|671180A1D267729FF59C449B8FDFA9E1990D9F67|ydaC]
description
[pubmed|22383849]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|26577401], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|671180A1D267729FF59C449B8FDFA9E1990D9F67|ydaC]

2022-11-19 17:26:54

Bzhu

11

6f3dfa132c35dd339e8ab4bc62ca075b7121ad92

F8329B177624CC34F04C4653A1E667DA2AD3C149

Biological materials
Mutant
MGNA-C085 (ydaC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2083 NBRP B. subtilis, Japan]
BKE04180 ([gene|671180A1D267729FF59C449B8FDFA9E1990D9F67|ydaC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCGATGACGCCCTTTG,  downstream forward: _UP4_ACATAAAGTGGACGGGCTTC
BKK04180 ([gene|671180A1D267729FF59C449B8FDFA9E1990D9F67|ydaC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCGATGACGCCCTTTG,  downstream forward: _UP4_ACATAAAGTGGACGGGCTTC
References
26577401

671180A1D267729FF59C449B8FDFA9E1990D9F67

Page visits: 943

Time of last update: 2022-11-27 00:01:39

Author of last update: Jstuelk