SubtiWiki SubtiWiki
dhaS

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

dhaS
168

3-hydroxypropionaldehyde-specific aldehyde dehydrogenase (NAD)

locus
BSU_19310
Molecular weight
53.71 kDa
pI
5.02
Protein length
Gene length
function
unknown
product
aldehyde dehydrogenase (NAD)
essential
no
synonyms
dhaS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1012

This gene is a member of the following regulons

Gene
Coordinates
2,100,580  2,102,067
The protein
Catalyzed reaction/ biological activity
aldehyde + H2O + NAD+ --> carboxylate + 2 H+ + NADH (according to UniProt)
Protein family
[wiki|aldehyde dehydrogenase family] (according to UniProt)
[wiki|Cofactors]
NAD+ [Pubmed|25409630]
Structure
[PDB|3RHH] (from ''Bacillus halodurans'' C-125 complexed with NADP, 32% identity, 64% similarity)
[PDB|4PS9] (from ''Bacillus cereus'' (62%))
Paralogous protein(s)
[protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|ywdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|gabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|aldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY], [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC], [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD]
Expression and Regulation
Operons
genes
[gene|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS]
description
[pubmed|22383849]
Open in new tab

[gene|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS]

2021-12-04 19:41:30

Jstuelk

2

cb67781772d2b5f2453fc57093a55234ac4a18fb

4432681E67D80C801F9152C1CAC31DB00D7E8333

Biological materials
Mutant
BKE19310 ([gene|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCGTAACAAACCTCCAG,  downstream forward: _UP4_TAACATGTATGTTTAAAAAA
BKK19310 ([gene|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCGTAACAAACCTCCAG,  downstream forward: _UP4_TAACATGTATGTTTAAAAAA
References
25409630

67A72A0EABCD807C25D8EAC61C251142B45C174E

Page visits: 1406

Time of last update: 2022-01-25 06:49:27

Author of last update: Melvin.boenninger