mrgA

mrgA
168

iron storage protein, DNA-binding stress protein, forms highly stable, multimeric protein-DNA complexes which protect against oxidative killing

locus
BSU_32990
Molecular weight
17.19 kDa
pI
4.6
Protein length
Gene length
function
iron storage,
product
mini-ferritin, DNA-binding stress protein
essential
no
synonyms
mrgA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0783

This gene is a member of the following regulons

Gene
Coordinates
3,383,565  3,384,026
The protein
Catalyzed reaction/ biological activity
forms highly stable, multimeric protein-DNA complexes which protect against oxidative killing
Protein family
dps family (with [protein|11D04B31B4BF223E276077EC16BBDA566694CBF6|dps], according to UniProt)
[wiki|Cofactors]
contains an iron-sulfur cluster
Structure
[PDB|2CHP] [pubmed|16893214]
[AF|P37960]
Paralogous protein(s)
[protein|11D04B31B4BF223E276077EC16BBDA566694CBF6|dps]
Expression and Regulation
Operons
genes
[gene|D945CAD7209CB94A7B9E23263476124B7E8853DD|yusZ]-[gene|68EFECAC6B771D7BDCCD7FD30511152EDEFCEE5B|mrgA]
description
[Pubmed|22383849]
Open in new tab

[gene|D945CAD7209CB94A7B9E23263476124B7E8853DD|yusZ]→[gene|68EFECAC6B771D7BDCCD7FD30511152EDEFCEE5B|mrgA]

2022-06-11 08:22:46

Jstuelk

11

2ba587e72736efb541e681efe8f26aba5f45d8ae

1276D99E0499960F28719E2AF1ED4713AF69453C

genes
[gene|68EFECAC6B771D7BDCCD7FD30511152EDEFCEE5B|mrgA]
description
[Pubmed|8396117]
regulation
induced by hydrogen peroxide ([protein|search|PerR]) [Pubmed|11532148]
regulatory mechanism
[protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR]: repression, [Pubmed|11532148], in [regulon|protein:00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|14563870], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|68EFECAC6B771D7BDCCD7FD30511152EDEFCEE5B|mrgA]

2022-06-18 23:20:08

ghost

13

f4fe76ca8f56e94fe7bb74a7bf504522827aca85

A60A27E2AF19300F34482BD804D27C796AF41673

Biological materials
Mutant
BKE32990 ([gene|68EFECAC6B771D7BDCCD7FD30511152EDEFCEE5B|mrgA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGATAACGTCCTCCTT,  downstream forward: _UP4_TAACAAAAAAGCTGAACCTT
BKK32990 ([gene|68EFECAC6B771D7BDCCD7FD30511152EDEFCEE5B|mrgA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGATAACGTCCTCCTT,  downstream forward: _UP4_TAACAAAAAAGCTGAACCTT
References
Reviews
15222465,35380871
Original Publications
9393687,14563870,7667267,12486061,8396117,9393707,8709848,8932315,11532148,16893214

68EFECAC6B771D7BDCCD7FD30511152EDEFCEE5B

Page visits: 3730

Time of last update: 2022-06-26 10:17:23

Author of last update: Jstuelk