

similar to multidrug efflux transporters

Molecular weight
49.09 kDa
Protein length
Gene length
putative multidrug exporter
yojI, norM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0534

This gene is a member of the following regulons

2,119,393  2,120,751
The protein
Protein family
[wiki|MOP exporter family]
[wiki|multi antimicrobial extrusion (MATE) (TC 2.A.66.1) family] (according to UniProt)
[PDB|3MKT] (multidrug exporter from Vibrio cholerae, 37% identity) [pubmed|20861838]
cell membrane (according to UniProt)
Expression and Regulation
Open in new tab


2022-11-18 00:43:10





Biological materials
MGNA-B427 (yojI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1426 NBRP B. subtilis, Japan]
BKE19440 ([gene|692C2F92DBE9E917697A883DA66C6E0FA2DE3FBA|yojI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE19440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACATTGATCTCCGTTTC,  downstream forward: _UP4_CACATTTAAAAGAGGTGATC
BKK19440 ([gene|692C2F92DBE9E917697A883DA66C6E0FA2DE3FBA|yojI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK19440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACATTGATCTCCGTTTC,  downstream forward: _UP4_CACATTTAAAAGAGGTGATC
Research papers


Page visits: 1261

Time of last update: 2022-11-29 17:57:05

Author of last update: Melvin.boenninger