csoR

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

csoR
168

transcription repressor of [gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]-[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]

locus
BSU_33520
Molecular weight
11.34 kDa
pI
7.3
Protein length
Gene length
function
control of copper homeostasis
product
transcription repressor
essential
no
synonyms
csoR, yvgZ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1937

This gene is a member of the following regulons

Gene
Coordinates
3,443,896  3,444,201
The protein
Protein family
CsoR family (single member, according to UniProt)
Structure
[PDB|4M1P] (from Geobacillus thermodenitrificans, 59% identity) [pubmed|24831014]
[AF|O32222]
Effectors of protein activity
Cu(I) ions cause release of CsoR from its operator sites
Expression and Regulation
Operons
genes
[gene|6977F18870004AD236539D9409255815E6BE9241|csoR]-[gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]-[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]
description
[Pubmed|22383849]
Open in new tab

[gene|6977F18870004AD236539D9409255815E6BE9241|csoR]→[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]

2022-01-25 04:38:05

Jstuelk

13

eb86b49e4fa20367c75145f1a228f37db4b5da04

AAFF284B2BD1673523D4C48EA1D3231D7A156AFC

Biological materials
Mutant
MGNA-B604 (yvgZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1603 NBRP B. subtilis, Japan]
BKE33520 ([gene|6977F18870004AD236539D9409255815E6BE9241|csoR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCGTACACCTCTGTTTA,  downstream forward: _UP4_TAAAGCGTTTTTTATTGTAA
BKK33520 ([gene|6977F18870004AD236539D9409255815E6BE9241|csoR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCGTACACCTCTGTTTA,  downstream forward: _UP4_TAAAGCGTTTTTTATTGTAA
labs
[wiki|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
[wiki|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
References
Reviews
22918892,25209494
Original Publications
18048925,19168619,20233928,19168619,19249860,24831014

6977F18870004AD236539D9409255815E6BE9241

Page visits: 1826

Time of last update: 2022-05-26 02:10:35

Author of last update: Melvin.boenninger