

3-hydroxy-1-pyrroline-5-carboxylate dehydrogenase

Molecular weight
56.15 kDa
Protein length
Gene length
arginine, ornithine and citrulline utilization
3-hydroxy-1-pyrroline-5-carboxylate dehydrogenase
rocA, ipa-76d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1012

This gene is a member of the following regulons

3,878,966  3,880,513
The protein
Catalyzed reaction/ biological activity
H2O + L-glutamate 5-semialdehyde + NAD+ --> 2 H+ + L-glutamate + NADH (according to UniProt)
Protein family
[wiki|aldehyde dehydrogenase family] (according to UniProt)
[PDB|3RJL] (1-pyrroline-5-carboxylate dehydrogenase from ''Bacillus licheniformis'', 68% identity, 88% similarity)
phosphorylation on (Thr-2 OR Thr-4 OR Tyr-5) [Pubmed|17218307]
Paralogous protein(s)
[protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|ywdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|gabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|aldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY], [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC], [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD], [protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS]
Expression and Regulation
expression during spore [wiki|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|rocR]: activation, [Pubmed|8113162], in [regulon|protein:BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|rocR regulon]
[protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]: activation, [Pubmed|7565595], in [regulon|protein:62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]: sigma factor, [Pubmed|8113162], in [regulon|protein:1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL regulon]
additional information
expression of the ''[protein|search|rocA]-[protein|search|rocB]-[protein|search|rocC]'' operon is increased upon depletion of ''[wiki|nusA]'' (resulting from increased ''[wiki|ahrC]'' expression) [ Reference]
Open in new tab


2022-12-03 14:40:30





Biological materials
BKE37780 ([gene|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGTAGTCCCCCTCGTG,  downstream forward: _UP4_TGATTTGAGAGAAATAAAAT
BKK37780 ([gene|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGTAGTCCCCCTCGTG,  downstream forward: _UP4_TGATTTGAGAGAAATAAAAT
GP3727 ([gene|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA]::tet trpC2) available in the [wiki|Stülke] lab
GP3747 ([gene|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA]::aphA3 trpC2) available in the [wiki|Stülke] lab
Expression vectors
pGP3792: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172], available in [wiki|Jörg Stülke]'s lab


Page visits: 3410

Time of last update: 2022-12-04 03:35:15

Author of last update: Robert.warneke